GenePrediction:GLEAN_6621 Details

Name: GLEAN_6621
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1121379..1120300 (- strand)
Length: 1080
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1121379..1120736 (- strand)
Length: 644
Type: CDS
Source: GLEAN
Position: GCSC_156:1120681..1120300 (- strand)
Length: 382
>GLEAN_6621 class=GenePrediction position=GCSC_156:1121379..1120300 (- strand)
ATGTTCTGGCAATCTGCTCTCGCCGCCGCCCTGTTCGGCATGCACGCACATGCCGGCATCGACGGCATGGCCTCCTCCGG
CGGCATGATGGCCGAACGAGACACCGACCAGCTCGAGCAGCGCATGGCCGCGATGATGGGGGACAGCCTCGGATCGATCG
ACAACCCGTCGCTCGGCTTTGCCAAGCGTGAGACGGCAAATTCGTCGGTGGCCAGCGACGTCATCCTCAATGCCGACGGC
ACCATCGACATGACTGCCTGGGACGCCACTGTCGAGGCGGCTTGCGTCTCGGCCCTCAGCAAGCTGGCCCAGTCGTCCAA
TCCGTCGGGTGCCTGCACCTGCTACAACCTTCTCGTCCTGAACAATGCCACCGGTACCTTTGAGGCCGACCTGCGGCTCT
ACCAGCTGTCTGCTGCGCGAGACGAGTTTGCCGGCATCGCTCCCGACAAGATCATGGTTGGCCTTAGCTACACCGGCGCC
TCGGTCTCGCCCGTCTCGACTGGCACCACCTCCTCGAACATCTCTGCACGGCAGGCCGCTGCCAACATGACCATGGCCAC
CACCAACTCAGACCTCAAGCTGCTGCAGACGTACATGTTTGTGGGCCAGATCAAGAAGGAAGCCCTGACCGGGAACCTGA
CCATGTATGTTGCATCTCGAGATCCAGTACCTGCAGCGGGTTTCTAACACATTTTTAGGGCCGCTCTCGAAGCGCTCGTC
ATGCCCATTGTCACGCTTACCGGCATCAACAGCACCGGCAGCACTGTCTCAACCAACGTCTCGTCCAATGAGGCCTCGTT
CGTCGCCGGCATCTTCAGCGACCAGGTCGTCCTGTCCAAGTCGGCCATTGCCGCAGTTGCCGTCAGCGCTATCATCGAGG
AACTGCACAACGGCACCGTCGCCTTTGTTCTCCCTGGCGTCCAGCTCATCTTGTTCCCGGTCGGCCTGATCATCACTAGC
ATCTGGCTCGTCATCGGTGTGGCTTTTATTGGCTTCGGTACCTACGAGCGCATCAACTATCGCGAGCAGTACAACCGCCG
GACAACCAATGCAGACAGGCCTGCACCGAACAGGATATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62