GenePrediction:GLEAN_6623 Details

Name: GLEAN_6623
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1116014..1114018 (- strand)
Length: 1997
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1116014..1115865 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_156:1115811..1115547 (- strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_156:1115443..1114507 (- strand)
Length: 937
Type: CDS
Source: GLEAN
Position: GCSC_156:1114444..1114018 (- strand)
Length: 427
>GLEAN_6623 class=GenePrediction position=GCSC_156:1116014..1114018 (- strand)
ATGATAGATACCGTATTGTCGACCAACCAGATCGCGGCGATGGACGCCAGCTATCTCTCGCAGCAGGTCAATGCGATCAT
AGGCCAGCTCCACGGACTCTTTGATGAGATCGGAGTGTCGAACCACGAGCGAGAGACACGCGAAGAGGAGGTGCGTTGGC
GAAACAATTACGCGGCCGTTTGCCCGCCTGCTAACTGATGCAGCTGTTTAATGCGCTCTCAGAGGCGCTGCACAACCAGG
TGCGGCTGGTGACGACGGAGAAGAAGACCATGGTGGAGGAGGCGCAGCGGATGATCAACGGCATCCGGCAGATGGAGGTG
TCGCTGGGGGACTCGCGGTCACGCCGCGACTATGAGGACGAGGAGGACCTCAAGGTGTCGTACCCGCTCTCGCGCTGTCT
GCAGGCGCTGAAGGAGAAGCACCAGCAGATGGGCAAGATGCACCGGGAGCGTTTCGAGCAGGTGAAGAGTACGTTTCGGG
GGAAGAAAACGAGAGAGTGCGTGTGCAAGTGAGGACAAGGCTGACTGAGCAGAACTTGCGGATGCGCTCCAATCATATTC
ATCGCATCTAGAGAGCACGTTTGTGCGGATCCCACTACCACCGACGGGACTGAACCAGTCAATATCGCTCAGCTTCGACC
TGTCGCCCGCATACGTGGACCAGCTGGACGCGGAATTCACGCGGGTCTACGAGGAGTACACGCGGCGGGTGGCGACGGTG
AAGGGGCTGGCGGAGAACATCGTGCAGCTGTGGGCGGAGCTAGGGACGCCGCAGGCGCAGACGGACGGGGCGATCGTGAA
GCACTACCGCGACTCGCCAGAGCAGCTGGGGCTGCACGAGGAGGACCTGGCACGGCTGCGGGCGCGGCGCGATCGGCTGG
CAGACGAGAAGAGGGCGCGGGAGAGGCGGCTGCGGGAGCTACGGGCTGCGGTGGAGGAGCTCTGGAGCAAGCTGGGGGTG
GAAGAAGAGGAGCAGAAGGGGTTCGTGCGGGCGAACCGGGGATGTGGGATGCGACAGGTCAACGAGTACGAGGATGAGCT
GGCACGGCTGAACGAGCAGAAGCGACAGCACTTGCCGGCGTTTGTGGAGGACGCGCGCGTCCGGCTGCAGGAGCTGTGGG
ACGTGCTGTACCTGTCGGAGGACGAGATGCTGGCGTTCACGCCGGCGTTCTCGGCCGCGTACAGCGACGCGTTGCTGGAG
GCACACGAGCGGGAGATTGGGCGGCTGGAGGCGCTGCGTGAAGAGCGGGCACCGACGCTGGCGATGGTGGACCGACATCA
GGCGCTGATGCGGGAGCGGGACGAGCTGGCGGCGTCGAGCCAGGACGCGTCGCGGCTGATGATGCGTGGGCAAAAGGGCG
AGAAGCGTGATCCGGGCAAGCTGCTGCGCGAGGAGAAGATGCGCAAGCGGATTGCCAAGGAGCTGCCCAAGGTGACGGCC
GAGCTGTGTCGGGCACTGGAGACGTGGGAGGACGAGTACGGACGACCGTTCCTGGTGCACGGCGAACGGTATCTCGATGT
GGTGGAGGAGGGTGGAGGAGGAGGAGGAGCGGCTGCAACAACAACGACAGCAGCAGCAACTTCCACATCAACAATACCAT
TCTCGCGAACGGGTTCCATAAGACGAGCACCTCCAGGTGCCAGCAGCAGCACAAACAGCCGGACAGGACCACAGCGGCCG
CAATCACGAGCCGGAACCAAGACGCCGGTGGCAGCACCATCGACAGGAACAGGCGGAACACTCAAGCGGGCACCAGTGTC
GATTGCGGCAGCAGCAGCAGCGACGAACAAGATGACCAGCCCGACACGGATCCCGGGAGCAGCAGCGACACGAGCGCCTT
TGGGGACGCTGAAGCACGGGATGAACTCGCCGGAGCGGCCGCGAGCAGGGACATTGGGAAGCAGTATGATGGGAAGCGTC
GGTGGTGGGATGTTGCGGCCGGCACCGGTGCTGATGAGGGCACCTCCGCCGAAGATGCGGGATCTGACGGCAGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62