GenePrediction:GLEAN_6626 Details

Name: GLEAN_6626
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1096440..1094889 (- strand)
Length: 1552
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1096440..1096129 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_156:1096072..1095035 (- strand)
Length: 1038
Type: CDS
Source: GLEAN
Position: GCSC_156:1094972..1094889 (- strand)
Length: 84
>GLEAN_6626 class=GenePrediction position=GCSC_156:1096440..1094889 (- strand)
ATGAGCGGCTTCCAGAACGGGGCGGCGCCCGCACGCACCAGAGACGATGACAGCGATGTCGAGGAGGAAGCACTGGTGGC
CGACTACCGCGAGCAGGTCCAGTACGAAGACGGCCTCGACGAGCTGGAGCAGGTCAACTCCCTGACGCTGGCCCAGCAGA
ACGACGACATCCAGTCACGGCTCGCCGCCGCCGCACAGCCGCTCGACTTCTCGGCCCCGCTGGAGGTCAAGTTCCAGAGC
TACGACGCCTACTGCAGCCTCTTCCACTTCATCCTCAACTCCGAGGGACCGGTCGACCTGGAGCCTCCTTCGGTTCGTGC
AGCGTGCATGGAGGACGAGAGGGCAGCCGCTAACCTTGCCGGCTCTAGTACTACTGGGCGTGGGACGTGATCGATGAGTT
CATCTACCAGTTCAACTCGTTCTCGTCATACCGCATGCGCATCGCACGCCAGGCCAACAACGCGGAGGAGATTGCGATCC
TGCGCGAGAACCCCAACACGTGGGGCAGCTACAGCGTGCTGAACGTGCTCTACTCTCTGATACAACGGTCGCAGATCACG
GAGCAGCTGGCCGCCACAAAGCGCAACGAGGATCCGGCCGCCGTGGCCGGCGACTACGGCTCCAAGAACCTGTACCGCAT
GCTGGGCTATTTCTCCATCATCGGACTCCTGCGCGTGCACTGCCTGCTGGGCGACTTCAGCCTCGCGCTCAAGACCATGG
ACGACATTGAGCTGAACAAGAAGGCCATGTTCGCCCGCGTCATGGCGGCCCATTTCACGACGTACTACTACATCGGCTTC
TCCTACATGATGATGCGCCGCTACGCCGATGCCATCCGCATGTTCAGCCACATCCTCGTGTATGTGTCGCGCACCAAGAA
CTTCCAGAAGAACGCGCAGTACGACTCCATCACCAAGAAGAACGACCAGATGTACGCGCTCATCGCCATCTGCGTCGCCT
TCCACCCCACCCGTCTCGACGACGCCATCCACACCCAGATCCGGGAAAAGTATGGCGACCAGCTGCTGAAGCTGCAGCGT
GGCGGCCCCGAGTCTCTGCCCATCTTCGAGGAGCTCTTCAAGGCCGCGTGCCCCAAGTTCATCTCGCCCGTGCCGCCCGA
CTTTGACAACCCGGAGGCCAACGTGGACCCCATCGAGCACCACCTGGCCGTCTTCATGGACGAGGTCAAGACCAACATGT
GGGGCCCGACCGTGAAGTCGTACCTGCGCCTGTACACCACCATGGACTTGAAGAAGCTGGCCGGCTTCCTGGACGTGCGG
CCCGAGGAGCTGCGCTCGTACCTGCTCGTCAACAAGCAGCGCACAAAGCAGCTGCGGTGGACCGACCAGCGCCTGCTGGA
GGGCAAATGGGTCAACGTCAGCGACCTTGACTACGCCATTCAAGGGGTGAGTCTCTTGTGCCTTTGCTCCTCTCCGACTC
TGTCGACGGCGACTAACCCAAGATGCAGGACCTGATCCACGTCTCGGAGGCCAAGGTTGGCCGGAAACTGGTCGACTGGT
ACCTGCGCAACCTTTCACGGACCTACGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62