GenePrediction:GLEAN_6627 Details

Name: GLEAN_6627
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1092614..1090210 (- strand)
Length: 2405
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1092614..1092127 (- strand)
Length: 488
Type: CDS
Source: GLEAN
Position: GCSC_156:1091354..1090976 (- strand)
Length: 379
Type: CDS
Source: GLEAN
Position: GCSC_156:1090914..1090210 (- strand)
Length: 705
>GLEAN_6627 class=GenePrediction position=GCSC_156:1092614..1090210 (- strand)
ATGTCGAACGAGATGGCGTCGTCGCCATCGCCGCCGCAGTCTCCGACAGCAAAGCTGCCGCCATCCTTCTCCGAGGCCGA
CAAGAACTCGGACTCGGGCGTGTCGCCGATGACACAGGCCCCTGGCAAGGCCCTCAACACCGTTGCTGGGAGCGGTGACG
ACTATTTCCCCTCGACGAGCGAGCCGGTAGCCAGCATGCCGGCGGCCGTCGATGCCGGCGGCCGTCGCAGCGAACCACGA
CCCGCGCCCTCGGACACGTCGTCCAGCAGCGGCAGATCTGGCAACGCTGTCAGCCCTCTGTTCGTGCCCAAAGGTGGGGG
ACAGGGCCGTAAAGGCTCCCTTCTCGATCTCAACTATCCCGAGAGCAGCGACCGATGGTCGAGAAAGTCGTCCGCCGCCT
CAGTCTCGTTCCGCTCCCCGTCGGACCCAGCTCTCCCACAGGGCAACCCAAAGCAGAACCGGCTCCGCCGCTCGCCGTCG
CCCAAAAGGTATGTTTGCACTCGTTACCACCATCGCTGCAAGCTCTGCTAGCCGTCTCTCCTCACATATTCTCATACACA
CATATGCACATACACGCACCCACTCCCACAACTTCACATGCCCTTAAAATCACACACACCATTCCTGCATGAGCATGTGT
CTGAATCCCATAACCAATCGAACACGCACAACTGCATATGCATCCTGTGCGTCCTTCCCTCCCCGAAAGGCCCGTCTCAT
GGAGCTGGCGGAGACAAGGTTGCATGAAAATCTGTGGGGGCATATCGAAGGCAGTTGGCATATGTCTAGCGACGCTAGCT
GGGCCGCCCGAGCCTCCGTCTCGATGCCTTCGCTTTGGTGGCCCTGCGCCTAGCTGGAATTTGCTTTGCCCGGCGACTCC
ACCGCTATCGCCTCCACTTCCGGTCAGTGACGCTGTCTTATCGCCATAGCAAGAAACCGAAGGAACAAATGCTCGGTCTC
GCGACTACTGCTCAATGCGGACATGTGGACAACCCCAATTCTGCAGTACAGCCCGTCCTTTTCCCGGCCCTGTTTTCCAA
TCGGAGCCCCCTCTAACACAGTCACCCCACCTAAATCCGACACTCTTCCCTTCTGCTCCTTTCGCTCCCGTGACCTTCTC
GCTTTTTTCACCTTTCTTCACCTTCCCACGTCCTCCATCTGTGCCTTGCATCCCGGACCGTCTGGGAAGAGCGTTCTCAT
TTTTGCGATCGCTGCTGCCAACATCATGGCTACGCTGACACAACCGAAACCGAACGCTAGGTTCCGGCAGCATGTCGCTT
TCGACAACATCCCCATAGGGGAACCCACTAAATCAAACACTCTCAGCTACACATTGAGCATCAGCCATCATGGGTACCAC
CCTCGTCGTAGGTCGCGAACCATGATGGTCGGGCTTGACGAGAACGCCTATTCCGATGTCGCCCTTCAATGGCTGCTAGA
CGAGTACGCCGACGATGGCGACGAGGTCATCTGCGTCCATGTTACCGACAAGGATGCCCGTGCTGTTGAGGAGAAGAACT
ACAAAGCGCACGCAGACGCCTTGGTAGAACGAATCAAAGCAAAGATACCCGAGAACTGCGCGATCAGTATAAAACTAGAA
TACGCGGTCGGAAAGCTGCACGTCACATTCCAGAAGTTGGTATGATTATGTTGGAACTGTGTCGAATGTCAGTATTGTGA
TGCTTACGCACTCCCTTCAGATCCAAGTCTACCATCCTAGCATGCTGGTGGTAGGAACCCGGGGCCGCTCTCTCGGCGGC
ATCCACGGCCTAGTCACTAAGAACTCATTTTCCAAATATTGCCTACAGTACTCACCAGTCCCAACAGTAGTTGTTAGGGA
CTACGAAAAGAGGAAGAGGAAGAAGGATAAGAGAACAAACGACCCTTCACGACACAGCTATGCCGCTATGTTGGCCGCCA
CCCATGGCCAGCATGAAGCAGACCGAGAGGCGACCAGCTTATATGATATAGAGGCCCGCATTTCACCAGATGAGGAAGCC
CATAGGGTTGCCGCAGCCATCGGTCTCCCTGCGGCCTTTGACCCGACCTTGAAGCCTATTGATATTGATCAGTATCTGGG
CCGCCGTTCCCGGCCAAGCACACCGCCTGCGGTGGCGGCTCCTGAGGTCGAGGTGAAAGAGCCCCTCCCGTTGTTAGTTC
CGGTAGAAACAGCCGGAGCTTCCCTTGACAGCGAGGAGGATGAGAGTGCGGATGACGAAGAAGTCGAGTTCGAGGGCCCG
CCAGGTCAGCGTGTGCCCCAGGAAACCCAGGCAGCAAAGGAGTCACAGAAGCAGCAGAAGAAAAGACTTCACGACATGGA
AGTTGGAGAGGCGGCAGCTCTGAAACAGTCACTGGATGACGACGATGACGACGATGATGACACCGGAGGCGGGGCTGAGA
CCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62