GenePrediction:GLEAN_6628 Details

Name: GLEAN_6628
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1089569..1086108 (- strand)
Length: 3462
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1089569..1089507 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_156:1089430..1089410 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_156:1089318..1086561 (- strand)
Length: 2758
Type: CDS
Source: GLEAN
Position: GCSC_156:1086490..1086108 (- strand)
Length: 383
>GLEAN_6628 class=GenePrediction position=GCSC_156:1089569..1086108 (- strand)
ATGCCTGTCGTCAGCGCGGAAAAGCTGGCAGAGCTCCAGCAGCACGCCGACAATGTCCGCAATGTATGTTACAAAGTCAG
CCAAGGCTGTAATCCGTGTATTGCTGAGGTTGCTGTGTTTTACTAATGCTGTAGCTTAGATCTGTGTACTGGCACATGTT
GTAAGTGCGGCTCTGTGATTTCGGCCATATCCTGGTCATGGATTTCGCCTGGCCGTTTGCATATACTAAACAGGGTAATC
AAAAACAACAGGATCATGGCAAGACGTCCTTGACAGACGCCCTGATCGCCACAAATGGCATCATCTCCCCCAAGATGGCG
GGCAAGATTCGGTATCTCGACTCACGGCCTGATGAGCAGCTTCGGGGCATAACGATGGAGTCCTCAGCCATATCACTGTT
CTTCTCCATGATGCGGCGGCCCAGCCCAGACGCAGATCCAGTGGCCAAAGAATACCTTATCAACCTCATCGACTCACCAG
GACACATCGACTTCAGCAGCGAGGTGTCTACGGCATCGCGTCTCTGTGACGGCGCTGTGGTGTTGGTGGACGCCGTCGAA
GGTGTTTGTAGCCAGACGGTGACGGTGTTGCGGCAGACGTGGGTCGAGAAGCTGAAGCCGCTGCTTGTTATCAACAAGAT
GGACCGGCTCATCACAGAGCTCAGAATGTCTCCGGGAGAGGCGTTTGTCCACGTCAGCAAACTGCTCGAGCAAGTCAACG
CTGTTCTCGGCAGCTTTTTCCAGGGCGAGCGCATGGAGGAAGACCTGAACTGGCGGGAGCGTATGGACGAGCGCGTTGCT
GCAGCCAAGGAGGCACACGGCCAAACGGACAAGCCGCAGGCCGTTGAAGATGAGTTTCAAGAAAAGGACGACGAGGATAT
CTACTTTGCTCCCGAGAAGAACAACGTCATCTTCAGCAGTGCCATTGACGGGTGGGCATTTACCGTCCGCCAGTTTGCGG
TGCTCTACGAGAAGAAGCTGGGCATCAAGTCCAGGCTGTTGGAGAAAGTGCTCTGGGGCAACTTCTACCTCGACCCCAAG
ACGAAGAAGGTGCTGGGGCCGAAACATTTGAAAGGGCGGAACTTGAAGCCGATGTTTGTGCAGCTAGTGATGGAGCCCAT
ATGGGCGGTCTACAACGCCACGATTGGTGGCGAGCATGGGAAGGGCGACGCAGAAGCGCTCGAAAAGATCACCAAATCGC
TCAACATCACCATCCCGCCGCACATCAAGCGGTCCCGCGACCCTCGGCTGCTGCTGACGACTGTTTTTGCGGCATGGCTT
CCGTTATCGACGGCGCTACTCGTCTCTGTCGTAGAGTCGCTGCCTTCGCCACGCACAGCCCAAGAGGGACGGATGGCCGA
CTTGTTGGACCGAACGCCCGACCCGGATCACATCAGCGCGGACATCAGGTCGGCCCTAACGTCTTTCAGCCAAGCCAAGT
CGCAGCCGGTGGTGGTGTATGTGAGCAAGATGGTGTCTGTACCAGAAAGCGAGCTGCCCGAAAACAAGCGGCATGGAGGT
ACGCTGAGCCCGGACGAGGCTCGCGAACTGGCCCGACGCAAGCGTGCAGAGATTTCCCGCGCTCAGCAGGCAGCAGCAGC
AGCAGAAGTAGCAGCGGGCGGCGTCTTCCCGACAGCAGACGACGAGCGGTACATAACGTCGGCTCTCGACTCGGCAACAT
TGGAAGACAGCGATGCCGCCGGACAGCCAGAGGAAAGGCAGGACGACCCCGAGCACCTGATAGGCTTTGCACGCATATAC
TCGGGAACGCTCTCCGTCGGCGATGAGGTATATGTTCTGGCGCCCAAGTTCTCTCCTGCACGGCCGCACCAGCCGCCGGA
GCCGCAGAAGATTACGGTGCAGGCGTTGTACATGCTGATGGGCCGCAACCTGGAGCGACTGGACCATGTGCCGGCCGGCG
TGGTGTTTGGTATTCGCGGTCTCGAGGGTACGGGCGTGCTGAAGTCGGCTACTCTGTGCAGCCAGCTCGAGGGCGCCTGC
AACCTGGCTGGCATTGCCAGTACCAGCGGCAAGCCGATTGTGCGGGTGGCGCTGGAGCCGGAAAACCCAGCCGATCTGGA
CAAGATGATTGCCGGGCTGAAGCTGCTGGTGCAGAGCGACCCATGTGCCGAGTACGAGCAGTTTTCCAATGGCGAGCACG
TACTGCTGACGGCCGGCGAGCTGCATCTGGAGCGCTGTCTGACGGACCTGCGGGAGCGCTTCGCCCACTGCGAGATCCAG
GCCGGTGCTCCCATTGTGCCGTACCGGGAGACGATTGTGCGTGCCGACGAGATGCGGCCACCGGCAAACAAGGAACTGGG
ACGTGGTGCAGTGCAGAGCACGACGAGCTCGAAGCAGGTGTCGATCTTGCTGCGCGTCAGGCCGCTGCCGGCCGAGGTGA
TTGACTTCCTGGTCAAGAATACCATCAGCATCCAGCAGGCCTTTCTGAAGGGAGGAGATGCCGACGAGGCAAAGGACGGC
GGCGACAACGACGGCAACGATGACAACGACGAAAGCGGTGTGAAGATGCTGCCACCAGACGAGTTCCGTGCGCAGCTTCG
CGCGCGCTTCGACAGCTGCAAGGGCCGCGAAACCTGGAAGGGTCTTATCGACAAGATTGTCGCCTTTGGGCCACGCCGCA
CCGGATCCAACGTCCTGATCGACGCCACGACGGCCCAGAGCCTGCAAAAGGTCATTTCGGGCGAGCGTGCGGCCGACGAG
ACGGTCAGCCCGAGCCACTTTGGCGACAAGATCACGTATGCCTTCCAACTCGCCACAGCACAGGGACCGTTGTGCCACGA
ACCGGTGCAGGGCATCGCCGTGATCGTCGAAGACGTGAGCGTGACACCACCGTCTGAGAGCGGCGCTGCACCGTTGCTGG
CTCGCGATAATCTGGGCCGGCTGACCGGCGAGGTCATCAAGACGGTGCAGCAGTCGATCCACAAGGGCTTTCTCGACTGG
TCACCGCGCATCATGCTTGCCATGTATTCGTGCGAGATCCAAGCCAGCAGTAAGTGACCAGACGTCGTTTCGCGATCGTA
CTATCGTATGCAAGCACACAGCTGACCAGTTGTTCTTAGCGGAGGTCCTGGGCCGTGTGTACGACGTGCTGACTCGGCGT
CGTGGCCGGGTGCTGTCGGAGACGATGAAGGAGGGCACGCCCTTCTTTACAATCTTGTCGCTGCTTCCCGTGGCCGAGTC
GTTTGGCTTTTCCGACGACATGCGCAAGCGGACGAGCGGCGCAGCCCAGCCACAGCTGATCTTTGCCGGCTTCGAGGTCC
TGGACGAGGACCCGTTCTGGGTGCCGTTTACCGAAGACGACCTCGAGGATCTGGGCGAGTATGGCGACCGCGAGAACGTG
GCCAAGCGGTATATGGATGGCGTGCGGCGGCGCAAGGGCTTGTTGGTCGAGGGTCGGAACGTGGCCATCGATGCAGAGAA
GCAGAAGACGCTCAAGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62