GenePrediction:GLEAN_6629 Details

Name: GLEAN_6629
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1082443..1081604 (- strand)
Length: 840
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1082443..1082326 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_156:1082261..1082148 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_156:1082091..1081975 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_156:1081905..1081604 (- strand)
Length: 302
>GLEAN_6629 class=GenePrediction position=GCSC_156:1082443..1081604 (- strand)
ATGACGCAACCAGACACAGCCACTCCGGCCCGGCGCTCTACGGCAGCACAGGGACAGCAGCTGTCTCCGGAAGTGCTCGA
GATCCTGGTGCCAAGTCTGCAGGCTGGCCTTGGGGCTGGTAAGTCGTACTGTCTGCCACAAGGCTGCATGTCCATCACGC
TGACTCGCGCGCGCCGTCACAGGCACCGTTGGACTGTTCGTCGGGGCGGCTTCTGGAATCGCACGCTCGGCAGCTCCCGT
TCTGTTTTCCGTCGTCACAGGAGCGCAATGGTTTGTTCTCGGCAGCAGCTACTCTGGTAAGCAACTTCTGGCGCAGACTG
CACCACATCCTCCTCCTAACGCTCTCCCACAGCATCCAGGACCGCTCTGATCAAGGCCTGGGGAGGGAATGACAATGTCA
GCCAGCCAGACAAAGTAAAAGTCAGCGCGCTTGCAGGCGCATCGGCCGGTTTTGTCGGCGGCTTGATTCGTAAGTGGCCT
CATCGCCTGATTCTCTGCCACTGGGCTGCAATCGTTTGGTTCCTTACGCGAAGATTAGGTGGGCCGCGAAATATTTTGCC
AGCCATTGCCGTGTTCTCGATCTTTGGTGCCACTGGCCAGGTGGCCGCGAATGCCATGTCATCGCGTGCGGCGGAATCTA
CAGGCGAAAAGACAGACTGGCTTGCGTCACGATGGAGTCCTTTGAGGGCGATGTCGGACGACGAGTATGCCCAGTTCATC
CAAGACAAGATCCTCAAGCTGGATGTGGAACTGTCCATGATCGACGATAAGATCGCCGCACTCGAGGCTGCAAAGAGCCA
GACTGGCAGCGGAACAGCAGGTGACGGGCCGAAGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62