GenePrediction:GLEAN_6631 Details

Name: GLEAN_6631
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1059979..1057017 (- strand)
Length: 2963
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1059979..1059782 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_156:1059713..1057958 (- strand)
Length: 1756
Type: CDS
Source: GLEAN
Position: GCSC_156:1057897..1057698 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_156:1057630..1057551 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_156:1057275..1057017 (- strand)
Length: 259
>GLEAN_6631 class=GenePrediction position=GCSC_156:1059979..1057017 (- strand)
ATGAGTCCCCGAAAGCGAATTCGAGCGAGCGTGTCCGATATCGCCTCACAGGGCGCAAAGGCAGCTGGAACTGCAGAACT
CGACCATGCGTGGGCTTCTGCTGTAATGGCAAAGAGCTCTAACGGCTCGGCGGGGCCCAGCGCGGCCGAAGGCTCCAGCA
ATGCGAGGCGACGCGTCTCGCTCGGTGACGCGAAATTTGTTTGTGTTTTTCCTGGCTGCATGCGACGCTCTAGCTTGCTG
ACTCCATCCTTGTTGTGACCATGTAGGGACCCCGGGGCTGGTACGGATCCTGGCCTCGTACGGGAAAGTCGGGCGCATCC
ACGCAGCTGGCAACCGACCCGATCCTGGGGGGCACAGTGAACCCGAGATCGCTGCCGGACTTCAGTCGCTACGACATACG
CAAGGCTACGGCCAACACGGACGGAACCGGCACAGGCGGGCCATCAAGGATGCACCAGTCCGTGGAGTTGCCGCCGCATG
TCTCCCCGTTGGCGGTGAGCCCGGTCCGGGTGGATTCGGCAGTTTCGCAGCCGGAAAGCGTGCCGACCCCTGTCTCTACC
GCCACAACGCTCGCTGATGCACAGATAGTCGACCAGCCCGACACTGTCGCTAAAGCAGGCGCATCGGCTTCACAAGGAGT
TGAAGTCAACCCCCCTGTGCCCGCAGCAGCACCAGCATCGGGTTGGTTCTCCTGGCTTAGCAGGCCTGCACGTATGGAAG
AAAGCCAAGCCGTTCCAGCTCCGGCTCCGGCTTCAGCTCCGGCTTCAGCTCCGGCTTCAGCTCCGGAACCTGCCGTGATT
GCATCGACGAGTCTGCCGAAAGAAGACGAGGAACAGCAACCGCCCGAGGCGCTAGATACACCGAAACCGGCTGTTGACGG
CAGGACGGTGGCCGGGCGCATGTGGTCGTATATGTGGTACGGCAATGCGCCATCTTCTTCTGTCACGACACAACCTGAAG
CACAGAACAGCAAGGATGCTGCAATACCAGAAACAAGAACGGACGGAGGGTCTGGGGACGCCACGATGGAGGACACACCA
TCGGCTCCGATTCCAGTGCCAGCGGCCTCCACGGTCCCCGACAACGGGCAGGGCAGGGCAGCAGGGACACCGGGCTCCAT
GGCCCCAGTCGCCGCATCGTCAGGCTCTACGTGGGCATTCTGGTCGCGGGATGCGCGTACCAAAGTGGCCGGTAAGACAT
GCAGCTCACTAGAACAGGGCGAAATAGCCGTCATTGGCGAGCGGTCAGAGGCTGACCCGAAGCCGGCTTCGGGTGTGGAA
GGGAGGAGACCTTCATCCATTGCACCGTCTCTGAAAGATGTGCCGACCAGGGATACGATGCCCAGGGACACATCGAAAAA
GGGCAAAAGGCCGCGGCCGATGGATGTGAGTGACGAGATGTCGTCGGGTTCGTCAACACCCAGGCCTGAGGCATCTCCCA
GGGGTGAGTCTTCATACTCAAAGCAGACAACGGCCGGGAAGCAACCACAAGCGCGCCTGCAGCCATCAGTGAACCTTCTC
CTTCCGTCCTTTCAGAACACATACCGGCTCAAGCAGGACACATCCATCGTGCGACAGGTCACGCGCTTTTTGACGCGAGC
ACACCAACCGCCTGTAACGCACGTGTATCTCAAGACAGACCTGCCGAAGATCAATAAGGCCGTGGCCATTGGAGTGCATG
GGCTGTTTCCGGCTGCATACTTGAGGCCGGTAATTGGCCAGCCGACAGGAACGTCGATCCGGTTCGCCAAGCACGGGGCC
GAGGCAGTGAGACGTTGGGCGGATGCACATGGCTGCAAGGATTGCGAGATCGAGAAGATTGCGCTGGAGGGAGAAGGCAA
GATTGCCGACCGGGTAGACAACCTGTGGAAGCTACTGTTGAACTGGGTTGATCACATACGCGGAGCCGACTTCGTCATCC
TCGCATGCCACTCGCAGGGAGTGCCGGTAGGCATCATGCTCTTGGCCAAGCTCATCGAGCTTGGGATGGTCACGACAGCG
CGAGTCGGTGTCTGTGCAATGGGTACGTCACCCTGCTGGCAAAGCTGCGGCGCTGTTGCTAACTGCTGGGATTCTGTCAT
AGCTGGCGTCTCCTTGGGCCCGTTCCCTGACTACAAGTCTGGTCTTGGCATCCTAATGGGGTCTGCGGGCGAGCTCTGGG
ACTTTGCCAATCCAGAGAGCGAGATTTCCAAGCGGTACGAACACTCGCTGAAGACAGTGTTGGAATACGGTGCACGCGTC
ACGTACGTTGGCAGCATCGACGACCAGGTTGTGCCGTTAGAGGTGCGTGCCCCTCACCCCTTGTCGACTGCCGTTCCATG
TGTGCAGGATTGCTGATGCCCTATTTCAGTCCGCCTTGTATTCCCCAGCGCATCACCCGTATCTCTATCGAGCCGTGTTT
GTGGATGGGCGGATCCACGCTCCAGATTTGTGAGTTGTCTTTATTTCCGAGACAGAATGAAGCAATGGATTGTTAACGTC
TGTTTGTTTTGCATTTATTAGTATCGCCAGTCTCGTGGGCTTTGCATGCAAGCTGCGCAATCTAGGAGTATCCGACCACG
GCTTGATCAGAGAGCTGTCGGTTCCTCTGGCAGGTAGTTTGTATTCGGGCGAGGGGCATTCACGTGTTTACGACGATCCC
CAGGTGTACGAGTAGGTGCTCGGTCCCCCTCTCTTCATGCACGGACGTTGGGCTGACATGACAGTCTTGCCGCCTCACAT
GCCCTGGAGACTGCAGATGTGGGCGCAATCAATTGCGAGGTCCGGGAGCGTGGTTCGCTCACGAATCCTAATCCGTACCA
CTTGCCGTGGATGATGCGCGGCATGCTCGAGGAAGAGTATGTCAAGACGGAGCTGTCTGCTGAGACGGCCGAACTCCTGA
AACAGTTTGACGAATGGAGGCCGGTGACCAAGGCGTTGAAGGACGTGAAATACAGACTCGAGGCAGTGCGGTCCAAGCTT
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62