GenePrediction:GLEAN_6632 Details

Name: GLEAN_6632
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:1053780..1051699 (- strand)
Length: 2082
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:1053780..1052663 (- strand)
Length: 1118
Type: CDS
Source: GLEAN
Position: GCSC_156:1052585..1052507 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_156:1052445..1051699 (- strand)
Length: 747
>GLEAN_6632 class=GenePrediction position=GCSC_156:1053780..1051699 (- strand)
ATGTTTACCCAATCCGTGCCAGCGCCCGCGCCTGCGCCCTCGTCCACGGGCCTGCACGTCGCCTCGTCCACGTCGCCAGC
ATTGCCAGCCTCCAGAACCAGTCGACTGCGCGGCCTCAGCTACCTGCGAAACTACACCCAGAGCCACCTGCTGAACCGAG
AGCACAGCGGTGCTTCCAATCCCAACAACGTGCCATCCTACACGAATTCGTCTGCATCTGCATCTGCATCTGCATCTGCG
TCTGCAGAGACTGCTGCACCCGTCAGCCGCATCGTCTCTCACTCTCAGGCGTCCAACAGCCACGACGTGAACGGCTCCCG
TCTCGTCCGCTCCGAATCATATCCCTGTCGGCCTACCCATTCGTCTGTAGACCACATCTTCGCCCTGCCGACAAGAGACA
GCCCTCTCGAGACATTGTCTGCAGCCGAGGACACTGGCATCACCACTGCAGCAACCACAGCAGCCCCAACGGCCACAACG
GCCACAACGGCCACATCGGCCCCAACGGTCGCCACGGCCACAACGGCCGCCCTCAATACAGTCTGCCTAATGGACGTGAC
ATCTGCTCCGTCAACAAACGGTCCGGCAGCGACGGCCATAGTCACGGCCACCACCGAAGGCAATGCCGGCTCCAATGCTG
CCGCCGGTGCCGCCACCTTGGATAGCTTGCCCTCCATCCGCTTCTCTACCTTTTACGACCCCCGCTCGACACGGCCATCG
CTCAAGTTCGCCACTACCTCTCGCACCCTGCCCACCGGCAAGGAGGTCATCCGCGTCGGTCGCTATTCAGAGCGCGACAG
CCTGCCAACCACCAGTCCGAATGCCCCCTCCGCCGCTCACGTTGGCTTCAAGTCAAAGGTCGTCAGCCGTCGCCACTGCG
AGTTCTGGTTCGAAAACAACCGCTGGTTCATCAGAGACGTCAAGAGCTCCAGCGGCACCTTCTTGAACCACATCCGTCTC
AGCCAACCCGGCACCGAGAGCAAGCCCTTTCCCGTAAACGATGGCGACGTCGTTCAGCTGGGCATCGACTTCAAGGGCGG
CGAGGAGATGATCTTCCGCTGTGTCAAGATACGCATCGAGTTGAATCGAGGATGGCAGAACAAGCTAAACGCCTTCAAGT
ATGCACTCTCTCCCTCCACCCCCTGCTGCTGCCTGGCCTGACCTGATATAGCATGAACACCCACAAGCGCCTTAGAAACA
TGACCAAGTCGAGCGATGGCGATGGCGCCACGCAATCGTCTCAGGACTGCTCCATATGCCTCAACTCCATTGCGGTATGT
GCTGCCTCCCCGCCCGACCTTGCTGTCGAAGCTGACCCGGCCCTTTGCCACACAGCCCTGCCAGAGCCTTTTTGTCGCGC
CTTGCTCGCACACATGGCATTACAAGTGTGTCCGGTCTCTGCTCGACTCGCCCCAGTACCCCGGCTTCATTTGCCCCAAC
TGCCGTGCTGCTGTCGATCTTGAAGCAGACGTCGAAGATCCTCCGGAAGAATGGGAGCACGGCGAGGCCGATGATGCTCA
CGAGCCTCTGCCAGGCGACAGCGAAGACGCCGAGAACCACGTCGGCACCCTCGCCGCTGCCGGGACACTCAACCAATCTT
GCGCGTCTCAGGTGCCGCCACAGCCGTCTCTGCCACCGCTGCACGCCGGCACAGCCGATCTCGTCGCCGATACTATTATA
CAAGCCGATCCCATGCAGGTCGACACCTCTCCATCGCCATCTCCAGCAGAGCCGCTGCAGCTGCGACTCCCGCTTCCGGA
AGACCACCTCTCCCACGCCACGGTTTACCCCATGTCAATCCCAATGCCATCCGCCGTTGGCCGCTTTGCCTCGTCCAGCA
CCAGTGGCCCCTCTGCATCTGGTGCCGCCTGCATGATTCACACATCCTCTCCAACCGCTGATGCCGTGGCATCTCACGGC
CATGATGGCCCCATCACTCCCCGCAATGATGCGGGACCATGGGTCTTCGATGGCAGCGGTATCCGGATAGCGGATGGGAG
GCCGAGCACAGATGGCCGAGGGGGAGGGATGCGCAGTCTGGACACAGCAGCCGCCGAACTGGCCGCTCAGTCCGAAAACT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62