GenePrediction:GLEAN_6641 Details

Name: GLEAN_6641
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:994917..994260 (- strand)
Length: 658
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:994917..994880 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_156:994785..994662 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_156:994448..994260 (- strand)
Length: 189
>GLEAN_6641 class=GenePrediction position=GCSC_156:994917..994260 (- strand)
ATGGCGAACACACGTGTTGTCTACCGTCGGCGCAACCCGTAAGTACAGTTTGGAGTCTTGCTCCTATCTGAAACTACCCT
TTTTTTACATCTTCCAAGCTGTGCAAAGACCAATATTAACCTCAGTCGACAGGTACAACACAACGTCCAACCGGACGCGG
ATTGTTAAGACCCCGGGAGGCGAGCTGCGAATTCTTCACATCAAGAAGCGCGGAACGGCCCCGAAATGTGGTGATTGCGG
TTCCAAGCTGCCTGGTGTAAGTACTCTCCGCGCTCAAAATTGAAGAACACCACATCGACATGTGCAAGTGTAATGTATCT
AGTGGGCTAGCTTCGTACATCTTCGTTCTTACTTTATTGTGGATTTCTCGTGGCATGTACTGCAACGGAGATTCCGGATT
ATGCAGACGGAGACGGGAGTACATTTTCAATTTGCGTCACAATACTGACTCGTTTGCTCATGGCAACAGATTCCGGCCCT
GCGCCCCCGCGAGTACGCCCAGATTTCGAAACCGAAGAAGACAGTCCAGCGTGCCTACGGTGGCTCAAGATGCGCAAACT
GCGTTCAGGATCGTGTTGTCCGGGCGTTCCTGATTGAGGAGCAGAAGATTGTAAAGAAGGTGCTGAAGGAACAGAGCCAG
AGTGAGAAGAAGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62