GenePrediction:GLEAN_6642 Details

Name: GLEAN_6642
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:991854..991035 (- strand)
Length: 820
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:991854..991148 (- strand)
Length: 707
Type: CDS
Source: GLEAN
Position: GCSC_156:991041..991035 (- strand)
Length: 7
>GLEAN_6642 class=GenePrediction position=GCSC_156:991854..991035 (- strand)
ATGGGATGCAATCTGGCTGCCCTTCTCGCAAGTCGACTTACGTCGCGCGAAGATAGCAGTACTACCGGTGATGCCCCGCT
TGTTATGGGCTTAGTTGCTCTATGCCCTACCACTGGGCCCCATGGTGTCGCCAAGGTAGCTATCTGCAAGGCTTTGCTCT
GTATACCATCTCCGATATTCAACGCCTGGAGAAGGTGGGATAGCCGCGGCGGCTCTGGCAGTCCTAGTGTTACCCGTTTT
GTTGGAGACGGTGCGGATGACGAAGCCAGATTGCTACAGCTACGTTATACTAAGCAGAGCAAGACCGCCGTGTGGCGTCG
CATGGCTTGGGGATGCCTTCCCGTTGTCAATTTCGGAACGTCAGTAGAGGGCGCCCCTGGCACGGACGTCTGGTCTATAC
TCCGCCTTCCTGTTTGTCTCATCACAGGCGAATCTGATCGTGTCACGCCGCCGGCAGAGGCCAAAAAAATTGCCCGGGTT
CTTTCTTCTGGAACGCAGGGCGGCCCTGGTGGGACTAGCTATCCAACCCTAGCCGATGCCACCCATCTCCAGCTTACTGG
CCCGCTCGAAGGAGACCGTACTGACATGCCTGGTCAATCACGGGAGCTTCCGTCCAGGATGGGGACGCTCCTCACAGCGG
CATCTTCATCCCAGCCGGATGCCTCGCAGTGCGCTGGCACCCCACCTCTGCAGCTCGAACCACTCAAGTATGTAGAATTG
CACGTTGTCCCGTCTCCGGCTGCCCATGGCTTGCTTTACGTCCCATCAACTGTCAGTGTTGTCTCAGCTCTTGTCAATAA
TTTCTTGGCACAGCATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62