GenePrediction:GLEAN_6643 Details

Name: GLEAN_6643
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:951376..950468 (- strand)
Length: 909
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:951376..951177 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_156:950833..950701 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_156:950617..950468 (- strand)
Length: 150
>GLEAN_6643 class=GenePrediction position=GCSC_156:951376..950468 (- strand)
ATGCTGAGAGAACAGGGGGAAAATCGGGGAGAGCAGCACCAGGCGGCGGCGGTGGCAGTGCAGTACTTCAGCTTCGACGA
GAAATATGCCAGCAGCGAGCGGTGGCAAGCGGCCAGCGACGTCGTTGTTTTTGATCTGAGGCGGCACGACAGTCCGGCTC
GAGCCTCAAGCTGCAGTGCAGCTCGCAGGACCACCGCAAGGTGCGTGACTGCTGGCCGGGGCCGAGCAGATCCAGCTAAC
AGCCGCGTCCAAAAACCAGACCATTGCCATGCTGCTTTCCGCAGCCTCAAGACCAGCACGGCTCCCTGGTTTTAGGCTGA
CTGCTCACACTACAATAAGGCCTTCTCTTGCCTCATCTATGCCAAGCGGCCGCTGCTCCTTGAGGAGGTATGGAAGCTGC
TGGACAGAGTCGATCTGCCGGCCGGTCAGTGGCATGTTTTGGATATCCCTTTGTTTTTTCCCGAGGCCTTCTTCTCTGGA
CTTGCCCCGTGTTGACCTAGCCGCTGTCATTAAAGCCAATATGTCTTTTGGAGCCACTCGCAGGACATCGCTTGACGGCT
TCCACCCGGCTCGTCCGCTGCTGGTGTGGCCGCTATGCGGCAACGAGATCCTATTTGTGCACTACACCCACAAGACCTAC
TTCTTGCGCATCCTCGGCTCCAATGCCCGGTCAATTGTGAGATCTCCGTGCAGGCCAGTTTCTCCAACTGCGGCCACTAC
CTGCACCTTGCGGCCCTGCACAGCTAAACGGTGTGCCAGCCCGACACTGACGGCGACACGACTGCCAGATTGGGCCTGCG
CATGCAGCTGTCGACGTACCGCCTCGCCATCGACCTTGACATGTTCCTCTCGCCCGGTGTCCGCCTCTGCCTCTCGCAGC
TGCCAAGAACCCTGTCCTGGACGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62