GenePrediction:GLEAN_6644 Details

Name: GLEAN_6644
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:950428..949290 (- strand)
Length: 1139
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:950428..950234 (- strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_156:950172..949949 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_156:949314..949290 (- strand)
Length: 25
>GLEAN_6644 class=GenePrediction position=GCSC_156:950428..949290 (- strand)
ATGCGCGTGCTGCTGTACACAGGCCTGCCGGACAGCCTGCTCACGAACACTGCCAATACCGGCGACATGCATATGCCCAA
CTTAGTCGGCCTGCGCAAGTTGTACTTTGTGCCGCAGGCTGAAGCGCCACCAAAGATGAAGAAAAAACCAAAAATGGAGG
TGCCGGCGGCGTTTACGTGGCCACCGTCCTACTCGGTGCACAGAACACAATGAGGCCAGCAGCCGCGGGACTCCGATCGA
CCGCGGCCCCCTATAGGGCGCCCACTTGAAGGCTGTGCAATCCGGCCACTGGACAGAAGCGCTACCGGAAGCTGGAGATG
GCCGAGGACTTTTGGGGGCCTCAGGACCAACCGTTGCCCCAGGGACGTTGCGCCGCGCCGAGACGTGGTGCGGCGGACAG
TTTCTGGCGCGATATGAGAAGTTTGATACGGATGAGGACTGCAACATCGTGCCCCAACTAGGGCAGCCCCGTATAGAGAC
GTAATGTATTGGACTGTATTTTTCCATCTGATTTCACATTATAACTGATAGACGAAAGGAGGAATCGAACATGAACAAAC
GAAAGAAGAGAGGTGAAATTCCATGTTCTAAACGCTCGTAGGACAGAGGCGGTGAGAGTGATCCCGTGATTGTACGCTAA
ATAAAGGCGGTGTACGGAGTAAACCCGAACAAAACAGGGCCCACCGGCCATATCGCGACAATACAAATTTTCGAAGTTCG
CCGCTCAATACCTCTCTTACTCTGTCGTGACAGCGCCTGACCGCGACCGCCTCCATTGAGTAAATAACGGTCACCATCAA
GAACGCACAACAGCGAAGACGCCCAGAAAACGATGGCTTCACGCGAGCAATACGTGGTGCCCACGTCATCCACCCAAAAC
CAGTCTTTTTCCGCGCCCAAGGCTTACGGTCAAGACTCCAACTCAGAAGGTGCTCAAATGAACTACCTCTGTGCAGACTG
CGGCATCAAGAACACACTGCGGCACACGGACCCAGTACGATGCAAGGAGTGTGGAGGACGCGTGCTCTACAAGCAGCGCA
CTAAGAGGTACGCAAGCTAGATGTGACGCAGGCAGCGCACTATGCATGCTGATGACGCCCATGTGGTATTACAGGATGGT
CCAGTTCGAGGCAAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62