GenePrediction:GLEAN_6647 Details

Name: GLEAN_6647
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:937464..935822 (- strand)
Length: 1643
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:937464..937281 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_156:937211..937198 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_156:937141..937026 (- strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_156:936968..935822 (- strand)
Length: 1147
>GLEAN_6647 class=GenePrediction position=GCSC_156:937464..935822 (- strand)
ATGCTTGCTACTCCGAGAATCATTGCCACGGCTGTGGGAGCCTCCGTCGGCTTCGCGGTTCTGGCCAATGCTGGCTTCAG
CTCCTCGACTGCCGACAATGTGGCAGTCTACTGGGGGCAGAACTCGTACCAACAGCCTACAGGAAGCCTATACTCTCAAC
AAAGGCTCTCGTACTACTGCTCTGGTAAGCCAAGCTGAACTCGTTGCTCTGTTACTATGCAGTGATTGGCAGTTGCTGAC
CGGTCTCGTCCAGACACTAATATAGATGTATGCCACTGAGGGAGAAAGCCGCGTTGCCTTTTCTAGCTAACATCATAACA
CAGATAATTCCTCTTGCTTTCCTGGACGCTATTTCAACACCCGTTGTCAATTTTGCGAATGCTGGCGACAACTGTACCGC
CTTTTCGGGGACTACCCTGCTGAGCTGCTCACAGTTAGAGTAAGGTGTTCGACGTATCTCCTATTGTATCGTGCTGCTAA
CGACCGCTACCTGCAGGGAGGATATTCAGACTTGCCAGTCCACATATGGCAAGACAATTCTTCTCTCCGTCGGTGGAGCA
ACGTACACAGAGGGTGGCTTCAGCACATCGACAGCGGCTACAGCAGCTGCGGACAACATCTGGGCCATGTTTGGCCCTGT
CCAGACCTCCAGCAGCGTGAACCGGCCATTTGGAAACGCTGTGGTTGATGGTTTTGATTTCGACTTCGAGTCTTCCACGT
CGAATATGGCCGCCTTTGCAGAACAGCTTCGTGCCAGCATGGACGCCGCTACCGCTGCGGGTGGAAAGGAGTATTACTTG
TCGGCAGCGCCTCAGTGTCCGTATCCAGATGTTGCAGACAACGACATGCTGTCTGGTGCCGTGTATTTTGACTTCATTAT
GGTGCAGTTTTACAACAACTACTGCGGACTCCAGTCCTTTGTCTCCGGCTCGTCATCGCAGAACAACTTCGACTTCAGCA
CATGGGACACTTGGGCGCAATCCGTCAGCAAAAATCCCGACGTGCGCATTCTTGTCGGAATTCCAGGAAGCTCTACTGCT
GCTGGCTCTGGGTACGAGTCTGGAAGTACCCTGGCGTCCATTGTGACGTATTTGAAGCAGTTTCCCACTTTCGGAGGCAT
CATGATCTGGGATATGTCTCAGGTCTACGCCAACTCGGGGCTTCTGGACGCCGTTGTGGCCGATCTGAAATCGGCAGCCT
CCACAACAACTGCGACAACCGTCCCTTTGGCCACACCAACGACCAGTCCGACGAAACCGACGAGTGAAACACCCCCGAGC
TCACCGAGAGCTGCGATTACACCAACGGGAACGATCCCGGCAGAGATGACACCGACAGAAGCCTTAACGACCGAATCGAC
ACAGATAGCAGTAACTCAGACAGCCGCCGCGACCGGGCTCTGCACCCAGTCCACCATCGTTTCGACAACGACAGTCACAG
TCACCGTGACGGGCGACAGTGCCACAACCCCAACTATTCCCACCAATACTACATTTACAACCAAAACTACATCGGCCACC
CAGACTGCAAAACCAGTATCGCAATGGGGTCAGTGCGGAGGCACCGGCTACACCGGCTCGACCACATGTGCAAGCCCCTA
TAGCTGTGTTATTTTGAGTGTCTGGTGGGCTCAGTGCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62