GenePrediction:GLEAN_6652 Details

Name: GLEAN_6652
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:917370..909978 (- strand)
Length: 7393
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:917370..917243 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_156:917187..916988 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_156:916929..915756 (- strand)
Length: 1174
Type: CDS
Source: GLEAN
Position: GCSC_156:915418..914148 (- strand)
Length: 1271
Type: CDS
Source: GLEAN
Position: GCSC_156:914080..913928 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_156:913868..913322 (- strand)
Length: 547
Type: CDS
Source: GLEAN
Position: GCSC_156:912724..912143 (- strand)
Length: 582
Type: CDS
Source: GLEAN
Position: GCSC_156:911908..910762 (- strand)
Length: 1147
Type: CDS
Source: GLEAN
Position: GCSC_156:910700..909978 (- strand)
Length: 723
>GLEAN_6652 class=GenePrediction position=GCSC_156:917370..909978 (- strand)
ATGGGCGACCTCACTGTTACGCTCACGGCGCCAAACGGCTTCAAGTACTCTCAGCCGATCGGCCTATTCATCAACAATGA
ATTCGTCAAGTCTCGGTCCGGTGAAACCATCACCGCGATCGACCCAGCGTATGTTCCGGTCAGACGAAAATGAAATGTCT
CATTGTGCTGACCCCGACTCCAGGACCGAGGAGGACATTGTGACCATCCAGTCAGGTTCGGCTGAAGATGTGGATTTGGC
TGTTCAAGCTGCGCATGCTGCTCTCCGCAACCCTGCATGGAAGAAGATGGCAGCATCAGACAGGGGCATCCTGATGGCGA
AGCTGGCTGATGAAATCGAGGCTAACAAGGAGCTTCTTGCCACCGTTGATGCTTGGGACAATGGTGAGACTCGCCATGAC
TGAAAGGGCACCGGTGCCCCAGATGACTAACGCGGGCACAGGCAAGACATACAGCGACGCTCTCAGCGTCGACCTGGTTG
AGGCCGCTGGAGTCATTCGCTACTACGCTGGCTGGTGCGATAAGGTCCACGGGCAGACCATCCCCGTGCCAAACAAGCTC
GCCTACACTCTTCGGCAGCCAATCGGCGTTGTCGGACAGATCATCCCGTGGAACTACCCCCTGTCTATGGCGACATGGAA
GCTCGGACCGGCGCTCGCCTGCGGCAACACGGTGGTGCTGAAGCCTGCCGAGCAGACGCCCCTCAGCATCCTGGTACTGG
CCAAGCTGGCCAAGGATGTGGGCTTCCCGCCTGGTGTCATCAACATCGTCAACGGTCTGGGCAAGGTGGCAGGCGCTGCT
CTTGTGCAGCACAAGCTCGTCGACAAGATCGCCTTCACCGGCTCTACTGCCACCGCCACGCAAATTATGAAGATGGCAGC
TGGCACGCTAAAGAACATTACGCTCGAGACTGGTGGCAAGTCGCCCCTGCTGGTGTTTGACGACTGCGACCTGGAGCAGG
CGGTCAAGTGGTCGCACCTCGGCATCATGTCCAACCAGGGCCAGATCTGCACAGCCACGTCGCGCATCCTGGTGCAGGAT
GCCGTCCACGACAAGTTCGTGAAGCTCTTTGTCGAGGAGGTCCAGAAGACCAGCAAGATTGGCAGCCCATGGGATGCCGA
CACGTTCCAGGGACCGCAGGTGTCCAAGAACCAATACGACAGCGTGCTCGCGCACATCGAAGCCGGCCGCACTTCTGGTG
CAACTGTCGCTACAGGCGGCCATGCGGTCAAGAACATTGGCAACGGGAAGGGGTACTTCATCGCCCCTACCGTCTTCACG
AATGTCACCAGCGATATGCGCATCTGGCAGGAGGAGATCTTCGGCCCGGTCGTTGTTATCAGCAAGTTCTCCGACGAGGA
GGAGGCAGTGCGCAGAGCCAACGACACCGTCTACGGGCTCGCTGCATCCGTTTTTACCATGAACATTGAGCGGGCACATC
GTGTTGCTAGCGAGATCGAGGCCGGCATGGTGTGGATCAACAGTAGCCAGGACTGCGACCCAAGGATACCATTTGGAGGC
GTTAAGCAGAGCGGAATTGGCCGGGAGCTCGGAGAGGCTGGCCTGGAGGCGTATTCTCAGATCAAGGCAGTTCATGTGAA
CTTGGGTAGTCGGTTGTAAGGAAATAGAAAACGCGGGGCTAACCCCTCTTGGTTGGGAGTAAATACGCATGCCAGATCAC
ATGACCAACACTTGGCACACAAGCACTTGTTACAGATGTCCGTAATGCCCGAATCCACATTGGACAGCAGATGCAGAAGT
ACAAAAGAAGACCAGAAGAGAAACAGATTGAGCTTGTGCAAGAACTTAAGTCACGCTCCCAAATCAAAGGCTTGAAAAGG
GTACTGGTGCGAACTCAACGGTGGCATAAAACCTTTGCACTTCAACACTTGCCCCTGCTCTCCTTTCCGCTCTGTTCTCT
ATATTCTACCGGCTCGACACGAACGTCGGAAGGAGGCGGTCAACAAAGATGGCGCCGAGAGCCACGCCACCGGCGGACGC
AGAAACTGTCACCTTTCAGCCAGAGGCGCTCCCGTCCTCGTCCCCAGCTCTGCGTATTGTGCATTTCAATGACGTCTATC
ATCTGGATCCCTCATCGGCTGAGCCGGTGGGCGGCGCTGCTCGGTTTCAGACTGTCCTCAATGAGTACCGCTCGTCTCCG
AAGTACAACGACCAGCCTGACCTCATTACTCTCTTCTCGGGTGATGCTTTCAACCCGAGTCTGGAGAGCTCGGTGACCAA
GGGCAGCCATATGGTCCCAGTGCTCAACGGCTTTGGCACGGACTGTGCGTGCGTCGGAAACCACGACCTGGACTTTGGGG
TAGCGCAGTTCCAGAATCTCACAGCCAAGTGCACATTTCCGTGGCTAGTCGCCAACGTCCTTGACCCGGCAGCCGGTGAG
GGTGTATCTATCGGCCACTGCCTGCCCACGCACATGCTGACGGCATCCAACGGCATAAAGATAGGCCTAATCGGCCTGGG
CGAGCGCGAGTGGCTAGAGACGGTCAACGTTTTGCCGCCGAACATTGTGTACAAGTCGGCGACAGAGACGGCAAAGGCGC
TGATCCCGCAGATGCGCAGTGCTGGTGCCGATATAGTCATCATCTTGTCACATGCCCGCGAGCCAAACGACAATAAGCTT
GCCGAGAACCTGGCGGGCGAGGCGGACCTCATTCTCGGTGGCCACGATCACTACTACTCGCATAGCCTGATCCAGGGGAC
CCATGTGCTCCGGTCCGGCAGCGACTTCAAGCAGCTCAGCTACATCGAGGCGTGGCGACGGCCTGAGGCCGATGACGCGG
CAGGGGCTAGCCCCAAATGGGATTTTTCCATCAAGAGGCGTGATATCGGATCGTGGATCGAACCGGACGAGCCGACGACA
GAACTAGTCGACCAGCTGACATCCAAGCTCAAGCAGAGCCTGGAAAAGCCCGTCGGGTGGACGGCAGCGCCTCTCGATGC
CCGTTTCACCACGGTGCGGACAAGGGAGAGCAATCTGGGCAACTTTGTGTGTGACATTATGCGCCACTACCACCAGGCCG
ACTGCGTGATCATGGCTGCCGGCACTGTGCGCGGCGACCAGATCTATCCGCCAGGGCCGTTGCGTGTCAAGGACATCACG
GACTGCTTCCCATTCGAGGACCCGGTTGTCGTGGTGCGGGCCACCGGAAAGGCGATCACGGAGGCTCTGGAGAACGGGGT
GTCGCTGTACCCGGCGCTCGAAGGTGAACGAGGTGGAGGTGAAGATGCAAGAAACAAAATTAGGATTTGCTGACAACGGA
TGTGCTGCAGGGCGATTCCCGCAAGTGTCCAACATCAAGTACGAGTTTGATCCAAGCCGGCCACCGAACTCTCGCATCAC
AACGGTGCAGATCGACGGGAAGCCGGCGGATCCGGAGAAGGTGTACATCTTGTGCACTAGAGGATACATGGTCCGCGGAA
AGGGTACGAGGGCCCTCCCATTCTCTGTCTCCCTTTCATAGCACTGACACACAACCTTTCAGACGGATATAAAAGCCTTT
TGGCCAAATCCGAAGGCGGGACCGTCGAGGAAATCATAGATGAGGAAAGCGGGATACTCATCTCCATGATGCTTCGGCAG
TACTTTATGGCCCTGAAGGTGCTCGACCAGTGGGGAGGGGACTGGAACGAGAACATGCAGAAGCGCTGGGGCAGCGTGGT
GTCAAGCATCGATCGCCGTCATCCACACCTGTTGCCCAGCGCGTCGACACCGCCCTCGCCCGGACACGGTGACGGCGATC
GTGCGGGCGGAGCAGCCCGGAGGTCGGCAGCCGAGCTTCGCCAGTGGTGGGCCAGCGTGGCGCCGTTTGACGAGTGCGTC
GTGGACGGGGCGAGCAGCCAGCCAGATGCTGACGAAGTTCATCGGATCGATCGACAGCTGCAGGTGATGCGGCGTATTGC
CCGCAAGTGGTGTCGTCTGGCCGGCGTTCAGAGCCACCAGTGCGACACCCTGACGGAGGACGAGTACCACGCAAAGTGGA
CGAAGGCCATTGCGCCGCGCATTGAGGGACGCATCCGGATTGTGGGAGAGTGAGGCCGAGAGCGATTGCATCACGATCTC
GCTACTACCTACTTCGTACCATGTACATACTGCATACGATCTGCATCCTCTCCCTGGCTCTTCTTTTCAAACGACGGTCA
TACGACGGGTCGCTTTGGCATAGAAAAAGCAAGACAATTGATGTGCATTGGCTTTATAGAATTTCGTGTTTCGCATTGAT
TGACTTTGCTCCATAAAGGACTAGCGGCTTGTCCGAGGCTAATACTTAGCACCGAGAATATATAAGCCACCAGTGGAGAT
TAGTGCTCGGTCTCCCTGCTAACGGCAGTCCGCACCAAAGCAAAGCACGTGCTGATTCAGTATCGGGAATTCGGTGACCG
CGTCTCGCTGTTCGAACCCGCGATACCACGTCCTCCAACCTCTGCTTCGCCGATAATTCTCGAGTCTTCCCCGCCGGTCT
TCCTCGTTTGGCCCACTCTCTTCCAGCTTGCCTGGCTGAGCTGTCAAATTCTCTTTTTGTGTTTCTGTTTCTGTTTCTGT
CTTCCATTTCGCTGTTGCTCCTCTTTTCTCTCTTTTGCCCGAGCCTCGCCCAACGACTCGACACCCCAAACGCATGCTCG
CGTCAGAAAGCAGTACTTTACGACGCGTGACGGAGCGTCCACCCGACACCCGGGACCATCAGCCATGGCCGGAGGAAGCG
CCCGCAACGCGCATGTGCCGGTGAATCCCAGCGGCCTGCGGCAGAGCTTCACGCTCGGGTCGCCTTCCCCGCCACACGAG
ATCGAGGCGCCACAGCACAGCCGATCTACGAGTCCCCAGCACTCGCCCCACTCGCAACCTGCCGTCCGTTTTGACAGCGA
CACGGTCGACGACCTGGATCTCGCCCACGCCGGTCCCAGTGAGCAGGACCCGCTCCTCCAGTCGACAGAGAGAGCCTCGC
TTTTGCGGAATGCCTTTAGCGACGGCCAATGCGTGCATCCGGGCCGCTGCAACCACGGCACCTTCTCGCCCCGGTCCTGC
AGCCCTGCAGCCAGCATGAACAGTTCTGGCTCCGGTCCCGACTCAATGGCTGGCAGCTCGACCGGGCCCACCGGAAGCCG
TGACAGCACCGGCTGGCGGCGAAGCTTTGTGCAGATCATGCGCAGCAAGAAGATGAGCACATCTAGCGAGCTCGCCGAGA
GGCACGGGGTGTCAGATACTGGGCTGATGTATGTTTTCTCTCTTTCTTTATCTCTCTTTCTTTATTTTTCTTTCTTTCTC
TTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTT
TCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTTTCTCTCTTTCTTTCCCTCTCTCTCTC
CCATACTAATGCCTCTGTTTAGGTATGTCGCCTACTATATCCCATCCGTGACCTGGATCAGCCAGTACAAGCTGTCGTAC
CTCAAGGGCGACTTCATTGCCGCCGTAACCGTTGCCGGTATCTACCTCCCCATGGCTCTGTCCCTCGCCAGCAATCTGGC
CCACGTCCCGGCCATCAATGGCCTGTACTCATTCTTCTTTGCGCCCCTTGTCTATGCCTTCTTGGGCAGCTGTCCGCAGA
TGGTCTTGGGACCCGAGGCAGCCGGATCTCTCCTCGTCGGCACTGTTGTCCGCTCAACCGTGGACCAAGGCCATGGAGGG
GAGGACGACGATCTTCTGCATGCCAAGATCTGCGGTGTTATTGCAGGTATCGCCGGCGCTACCGTTCTGCTGGCCGGCCT
CGCCCGACTCGGCTTTCTCGACAGCGTCCTGTCGCGTCCTTTTCTCCGTGGCTTCATCTCAGCCATCGGCTTCGTCATCT
TTGTCGATCAGCTCGTGCCCGAGCTCGGCCTCTCCAAACTGGCCGGCGAGACACCTGGCGTCATGCATGGAAGCACCGTC
GACAAGCTCCGCTTTCTGGGCAACAACATCGACAAGGCCCATACACTCACGCTGGTCATTGCCGCCGTCAGCTTTACCGT
CATCATGGTCTGCAGGGAGATCAAGCGCCGGCTGCAGCCTCGCTACCCGAGTGTGGCCTACGTGCCTGACCGGCTGGTCG
TGGTCATCCTGTCGGCGTACCTGGCCTGGCGTCTCGACTGGGAGAACCAGGGCGTGGAGGTCCTGGGCACCGTCAAGGCC
GCCTCTGGCCACATCTTCGCCTTCCGTTGGCCTTTCCGGTCGTCCCACATGCTCCACATCCGAGACGCCATGAGCACCTC
GTTCCTCATTGCCCTCCTCGGCTTCTTCGAGTCGTCCGTCGCTGCAAAGAGCCTTGGCGGACAGGAGACCTTCCCAGGCG
TCCAGCTCAGTGCCAACCGGGAGCTCGTCGCCCTAGGCGTTGCCAACTTCATTGGCGGCTGTTTCATGTCGCTTCCGGCC
TTTGGCGGCTATGGGAGGAGCAAGGTGAACAAGTCCACCGGCGGGAAGAGCCCCATGAGCTCTGTCTTTCTGAGCCTGAT
CACCCTGATATCCATCTTGTTCCTCCTCCCATACTTTTACTACCTTCCTGTAAGTAGCCCACTCATCTTGGGCGCTGAAG
CAGTTGTATCTGGAAAGCTAACTTTGTGAGAAACCGGTGCTTTGCTCCATGATCAGCGTGGTGGCTTGGTCTCTGATCGA
AGAGGCCCCTTCCGACATATCGTTCTTCATTCGCATCCACGCCTGGCCCGAACTGGGCCTCATGCTGGTCATTGTCCTTG
CCACCATCTTTTACTCGCTTAATTTGGGCATTGCCATTGGCATCGGCCTGTCTCTGTTGCAGGTGATCCGACACGCCACG
AGACCTCGCATCCAGATCCTTGGGCGCATTCCAGGCACGAACAGGTTCGAGAACGCTGAGGATCACCCGGAGCGTCTGGA
ATTTATCGAGGGCTGTCTGATTGTCAAAATCCCAGAGCCTTTGACCTTTGCCAACACCGGAGAGCTGAAGACGAGGTTGC
GTCGGCTAGAGCTGTACGGCACCAGCAGGGCCCATCCCGCCTTGCCACGACTCAGAGGGGAGGAGCTCAACAAGAATGTT
ATCTTCGACATTCACGGAGTCAGCAGCATGGACGGCTCAGGCATACAGGTACTCGAGGAGATCGTCCGAAGCTACCGTGA
ACGTGGTGTTCGGGTCTTCTTTAGCCGCGGCCCTCCTCGGGGCCATAAGGTTATGCAGCTCATGGACCTGTCCGGGATCA
CTGCTCTTGTCGGTGGAGATGGCCATTTTGTCGACGATGTGGATCTGGCCCTGAAAATGACGGAAGTCGAGGAGGGAAGC
GAGTTGGGAGTTCGTGAAGGCTCGGCCCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62