GenePrediction:GLEAN_6653 Details

Name: GLEAN_6653
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:904533..896458 (- strand)
Length: 8076
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:904533..904445 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_156:904347..903945 (- strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_156:903857..900158 (- strand)
Length: 3700
Type: CDS
Source: GLEAN
Position: GCSC_156:900103..899826 (- strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_156:899465..898673 (- strand)
Length: 793
Type: CDS
Source: GLEAN
Position: GCSC_156:898517..896458 (- strand)
Length: 2060
>GLEAN_6653 class=GenePrediction position=GCSC_156:904533..896458 (- strand)
ATGTCTTCCAATTTGACACCCACCAGCTTCGCGTCTGCCGCAGCAGGCCAGTCTCGAGGGTCACGGTCTGGCGATGGTAC
TGGTGACTGGTATGGCCTCTCTCCCTTGATCACCGCTCTGCCCGCCTCCTTCAACGAGACGAATCACAGCGTTGGAGACT
CCTGCTGACTTGTCATGCATTCGCAGGTCGCGACGAGAGGGCCGCTCCACAAATGGGACCTTGACATTTCGCCGCCCTAT
CACCACTCCTTCAAACCAGGCACCACAGACAGCCTCCGATGTGTCATCTGCCCTCCCACCGCTCGTGACCGAGACCTTGC
CGGCGCAAAGCCCCTCCCACCCGACTGACCGATCACTCCGCTATTCGCGCGATCATTTGCTGGACCTGTTCCAGGCCAAC
GGAAACGAGTCCGCTGACGCGTCAAATTTATTCGTCAGCGGGTGGAACCCGACACAGGTCAACGGGACGGCCAGAGGTTG
GGGTAAGAGCTTAGATGGCACTGTACCCCAGGATCCTACTGTCTGTTGGGATGCTGCCGGCAGTATTAAGCCGATCGGTC
TTCAAGATATGTCTGCAGAGGACAGCGAGGTACGTGCCGTAACAAGCCTCCACGCGCGCCAATGCCCGTGTTGAGTTCCG
TGTCTCTACATGTACGCTCATGGCTGACTTCGGCAGATGTTTGCTGATATCAATTCGACCCTGAAGCCACAGCCGCAGAA
AGATGGCGGTCAAGGACCTGGCGGCGTCAACGGAAGAAAGACCTCTACCTCCGTGTCCCACGGGAACGGAAGCGGCTTCA
ACGTGTCATCCCCTCTGTCTGCTTCCCGCCCGACCGCACGGCGAAGGGAGACGTCCGACACGAATCCATTCCCGAGTGGT
GCGGGCCTGATTTCTCCACTGACCAATCGAGCGCCCCGCGACGATTCCTCGTGGTTCGGACGAAAAGGAACCGATCAAAA
AGAACCACAACAATTTGAAGAGCCCGAAGAGGATACCAGCCCCTCGGCGGCTAAGGCCTCGGGCTTAGGCACCGGTGGAC
GAAGCAATACGGTTGGTGGAACGTCTTCGATGTGGGGCACTTCGACAACGGCTGCTGCTTCTACCGCCGCTGTTGGTGCT
TTTGGCAGTTTTGCGCTGCCTACCGTTGGCGACAAGCGTTTTGGCAGCACGCGCGGCGAGAGCCGGCTTGCTCATCTGCT
TCCCAAGCAGGATACCTCCGAGACCGGTGGCCCCGGGGCGAAGCCAAGCAGCAGCGCAGCTGGCAGCGCGAATGCCAAGG
AATCTTGGCGGCTGCGCCCGAGAACTGACACCGATCCGTTTGGCGAGGACACTGCCCCGGCGGGCGGCGCTTCTTTGGAC
AGCAGCCAGCAGAACGCAAATGCGGACTCGCAGACGTACCAGTCCTTCGGCACCCCGATGAAGAGCACAGGTGGCGACAT
TGGCGTGTCGGGACTGAATATGGGCTCGTCGATGGACAACGATGGCGCGGCAAGTCCGGAGACGAATCCGTTCCGCAGCC
CGCCTGCCGAACGTGGTGATAACGATCACTACCAGACAGCGGCTATGTCGAGCGGGCTCGAGAAGGGCATGGGCGCGATT
GGCGGCGGCGTGCATGACCACTCGTCCAATTTTGGCTCCATTCGTGGATATCCCGGCAACGCCTTTGACGGCAGCGATCG
CAGCCAGACTTCGAGTGTGGGTGCGAAGGGGTTTACCGGGCTCGGCAGCATTGCTGGCTGGGGCAACGCCTTGAACACGA
GCACCCCGGACCGGGAGCGTACCGTTTTTTCTAGCGCATTCGGAAGCTCATTGTTCAGTCCGGTCACGGGCGAGCTTCAG
TCGCCTGGCTTCGGCGGCGGCGTCCCTGGTGTGTTTGGGCCTCCTACTGGAGGGGGTGGAATCGGTGCAACTGGGTCCCT
GCGTGGTACAAGCAAGCTGGGATCGCTGTTCCCGCCAAGCATGCAGGCTCAGATGGTTGGTAGCCAGGATCAGGATGGGA
GCCTGAATGATTCTGTCCCTGATCTTCGCCAAACAAACCCACTCGGAGCAATTGGCCGGGAGGCCATTGGAATACAAGGG
CGAGATGCTGATATGGCATCGGCCAGGCCAGGCCGTGGCGGCTTTTTCGACGATCTCATGGACCCGACTCGGGCTGGAGG
CAGTGTTTTTGCGAGCGGCGAGCAAGGAGGACAGATGCTCGCCTCGACGTCATCGCCTATGCTGCAGTCGCAGGTGTACG
ATTCGATGTCGGGGCGTCCAAGCTCCGACACCCCCTTGAATCAACCTCGGATCATGGTCATGCCTGACCGGATGCGTTGG
GTGTACCTCGACCCCCAAGGCCAGACACAGGGCCCCTTCACGGGTCTGGAGATGAACGATTGGTACAAGGCCAACTTCTT
CACGGCTGACCTTCGGGTCAAAAAGGTCGAGGACACCGAGTTCGAGCCTCTGGGCCAGCTTATCCGGCGAATTGGTAACT
CCCGTGAACCGTTTCTTGTTCCTCAGATGGGTGTCGCTCACGGACAGCCGTCCCTGAGCGGCACATTTGCTCATGGCGAC
CGCGGTACCGTTATTCCTCCTCTGGTGGGTGCGTTCCCGAGCTACGGGAGAACCCTGACTGCCGAGGAGCAGAACAATTT
GGAGCGGCGGAAGCAGGAGGAGCAGTACATGCTGGCACGCCAGCGGGAGATGCTGTCTGTGCAGCACCACCCCTTCCCTG
GCGGCCGTGTGCCTCCCACATCTGCGACCAGCGCTCTCCACCACCACTCTAGTGTCCACAGCCTGCAGAGCCAACCTAGC
TTTGGCAGCATGACCGCTCCGATTGGTGCCGGCCCGCCTGCCATCCCAGGTGGATTGAGCGGTGGACAGGTCTTTTTCGA
CCATCCAGGCATGCTTCCACCGACTAGCCTGCCTGGCGTCTCGTCCGGCTCGGACCTTCTTCGGGACGACATCGGCGCAC
AAGACCGGCAGATGCTGTCTGGCCTGCAGCCGACAGGAGCAGTGCCAGGACCCTTTGCAACCCAACAATCGACTTCGATC
ACGAATGAGATGACAACCCGCAGCAACCTGCCGACCATGGACCAGCTGAAAAAGGACCCGCAAGGGTTTAGCGAACGCCT
GAAAGAGTTCCAGAAGCTCCGCGAGAACATTGATGCGGAAGACGGCTTGACTGGTCCGGGTGCCCCGTCGTCTGATGCGA
TCGACATCGCGCGGGAGGCCGTGGCACACCATGACCCCCAGCAAGCACCGACAGCCGCAGCTGTGGATGATGCACCACTG
GAACACTCAAGAAAAGCCGCCTCGTCAGCCGAGTCGGCCGCGTCGATAATGGCTGGCCTCTCCCTGACGCAGCAAGTGCA
GAAGGCCCAGGCTGCCAAACGTCTTGCCGAACAGGAAGAGGTGGACGAGATCGTCCAGCCGGCGGAACCACATCTCGACC
TGCCGATGCCTTTTCCCCCGCCACAGGGCCAGGCTGGAACGCCGATTGCGGCGCCCACGGCGCAGCGGTCGCGCTCTACA
CTGCCTGACCAGTATGCTACCAGCCGTTCCCAGTCAGAGACGCCGGAGAGCTCAACCGTCCAGCCGCCACCTCTGGCGCC
ATGGGCCCGTGACCACGTGTCTGAGAGCCACAAGGGCCCGAGCCTGAAGGAAATTCAAGAAGTCGAGGCGAAGAAGGCCG
CCAAGGCCGAGGAGGTTGCTCTGGCTGCCCGCAAGGCTATGGCCGAACAGGAGGCCGCTCTTTTGCGCGAACGCGAGAAG
GCCGCGGCCACAGTCGCACCTGGACTGCCGACCTCATCGACCTGGGCGGCCAGCTCGCCGACTGTTGCGGGGTCCAGCAG
CCCGTGGTCGAAACCCGGCGCAGCCAGCAAGCCTACTGTACATGGCGTGGCCAGCGGAAGCTCCACGCACAGCGCGGCCG
AAAAGAAGAAGACCTTGGCAGACATCCAGCGCGAAGAAGAGGCGCGCAAGCAGAAGAGCAAGGAGCTCGCATCTCTATCC
CCCGCGTCCCCAGCACACAGCGGAACAGGCAAGCGCTATGCCGACCTTGCCAGTAAAGTCCAGGCCTCGACGCCAACCAG
CCAGACTTCTGCCAGTGCCTCGCCTGTTCCTGCTGCCCCTGTCGGCAGCGGTTGGGCGACAGTCGGTGCAGGTGGCAAGG
TGAAGACGCCCTCTGGGCCCTCGGTTAGCCGCTCAGCAAGCACGTCGTCTCCGGCTGTGAAAACTGCTCCCACATTACCA
CCAATGCCCCGAGCCGCCTCCAAGCAGGTGTCTGGCGCAGCGACAGCGAAGCTGGACATCGGTGGCGTGGCTATGGAGGA
GTTCAACAAGTGGCTACATCGCGAGCTGGGCCGCGGAATCACGAGCGGGATTGACCGTAAGTAGGAGCTTCCTGTTCCGT
ATCCGTGCGGATAGCTAACCCGGTGCACAGTCGATGGCTTTGTGGATAGTCTCCTGCAGCTGCCCCTGGACCTGACCATT
ATTTCCGAGGCCGTGTATGCCAGCTCGAAGACGATGGATGGGCGCCATTTTGCAGAGGAGTTTATCCGTCGGAAGAAGCT
TGCCGAGAAGGGCGTGGTGGAAAAGCAGGCGGTGCCGTTGACATCTGGCGACAGCAAGAGCAGCGGTGGCTGGAACGAGG
TGGCGAAGAAGGGAAGCAGCAGCAGCAGCAGCCACCAAAAGGAGGAAAGCATGCCAGCTGGCTTTAAGGTAGTCCCAAGC
CGGAAGAAGGGCAAGAAATAGAGATGTTGGCACATCTCCAAGCATGAGCAGGGTGCTGTAAGACATAGCTGCTATTTTCT
GTCACAATCCACTGTTGCTATGTATCATAAAGCTACGAAAATATATGTAAGACGGCCGTTCTTTCTGAGCTAACAGTGAC
GCTTGCTCATCATTGCGCTGGCAACTACTGCGACGAAATTTCTTTTTAAAGCTATGGAGGGGTTCTATTGCCTTATCTAA
TCGCCGACATCTACCAAAAAAAAAGATTTCGCATCAGAGAACAGGACGTTTGAAAGGGAAGAGGAGCATACGAAATTGCT
CACAGAAAATAACGAGCGCTCTGCACAGATGGAGCTTGAAGCGCTCGTCTCGAACGGCCGGTACGCCGAAGTCCTTGTTC
ACGAGGACGCAAGGGCTCTACTTCAGGATTTTGTCAATTCGCAGCTGAACTCTGTTGGGAAGGGCGAGGCACCGAAAAAG
CACAACCTAGACGCTGGCTCAGCAGCTTTGTACGTCGGTATTGCTGCTCTGAATGCATTCTTGCAGTCAAATGTCACGGG
CCCCGTGCTCGAATCTGCGCAGAAGGTCGAGAAGCTGTTGGGTGCGCTGCAAGATAGCACCAACGGCACGGTGGATGGAG
CAGCGACGTCTCTGCGACGATCATGTCTGTCCTCTCTAGATGTGGACGGCATCTCCGTGTACCAATACATACAACATATT
GAGCTTTTCTGTCTGGCCAGATGGGTATTCGTTGCACACATGTCGGACGATAACGCCTCCACCCTAAGCGGGCCAAGACA
GGATATCGATTCTGATCCGGCAGGACAAAGCTTGGCGTGGATGAGGCTGCGCATTCATACGTGGCACTACAAGCTACTCA
CCGAGCCGAACCAGGGACCGGGGTCCGTGTTCAACAAGATGACACAGTGGAGTGAGCTGCCGAGCCTGCAGGAGCAGATT
CTGGAGTGTTTGGATGCGGTCGAAAAAGAGGTTCTGGACGGAGACGAACAGGCAGGCGACAACGCTACCTGGAGCAGGAA
GTCCCAGGTGCAGTTTCTGCTGGAGAAGATGAACGTATACGCCATGATAGGGCTGGATGCACAGGCGCAGGAAGCGTTGG
ATGCGGCGGCGAAACGGCACCGTTTTGAATATGTCCTGACCGGAGCGTTGGGAAAGCGGACACGGTTTCAAAACGAAAGT
ACCAGCCAGCTGGTCATTCTTGCACGGAGCTGTGAATCGAGTGCAAACGAGCGAGGGGTGCAAAAGCAGTCAATGACACA
GAGGACACCAAATCAGTTCCGCAGGCGCTGCAGCTCAACAACGACACTCTCCTAGAGACCATTGACTTCTCTGGGGCTAA
AGTTAGCAATGGAGAGGCAGCAGCTGACATCCCGGGTTCCCTGCGCGATCTGTTCCCCGACAACCAGCCGCCACTGTCGC
CTCTCGACCAGATCATCCTGCTTTCAGCCGCCACTCTGAAGGATGCCTTTTCTCCAGCAGACTCTCTTACGCTGGAGGAA
ATCCTGCCGTATGCAACTCGAGTACTTCTGGACAAGGCTACAAACTGGCAGATCTACTCGCAGGCCCTCATTGTGCGGTC
TCGCATCGAGATGCACCGCAGCCGAACGGTCGAACGAGGTGTGCTCCAGATGCAGGCGGTGGTCGACCAGGTGGTTGTTG
ACACGAGCGCCGAAGCCGAGACGACGAACGACGACAGTACCGTGACTATTCCTGCCATCGAAATCAGCACACCAGCTGGA
GATACACACAGCAACAAGCCGACGAGCTTCTTCCCGGCAGCGAAGCAGTCTGAGCAGGCTCCCCCACAGGAACGGTTACG
GTACATCAGCATGCTGTCCACGCCACCACGATGGCATCTCGAGTCTGAGCTGGCGTTTTCTTGGGCTGGCGTGGGCTCTC
TGGTGTCTGCACTCGAGATCTTCAAACGGCTGCGGCTATGGGCCGAGGTTGCGCTCTGTCTGGCGAGCAACAGTGCCTTT
GACGACGAGGGCGGCAGGGGCTCCGGGGGCGAGGAGAAAGCGAGGGCGCTGATTCGGTGGCAGCTGTTCAAGGCGTCTGA
TGCAGCCCGAGAGCCGGCCGGGGGAGAAGACGGCAAGGATGTTGATGTTCTAGCCCTACGGGCAACAGACTTCTACGGAC
CAGAGCGCGACCCGGCACCGGCCAACGCACCGCGGCTGTTCTGCATCCTGGGCGACATCGAGGCGGAGCCAAAACACTAC
GAACGGGGGTGGGAGTTGTCGAAGCATCACTACTCGCGGGCCAAGAGGTCGCTGGGCGAGCACTACCTGCAGCAGCATGA
CTGGGAGAGGGCACGAGATGCGTACAAAGATGCGGTGTCTGTCAACCGGCTGAACCCGCAGATGTGGAGCCGTCTGGGCG
ACATCCATCTCCGGATGGGCGTGTTCTCGGAAGCAGCAGAGGCGTTTAACCGGGCGATTGCAGCTGCAGGAGAGGCTGTC
GGCGGCGAGGATGCGAGGACGTGGAGCAATCTGGGCAGTGCTCTGTACAGCTTGTATACGGAAGGAATCAAGGAGCAGCC
GGAAGCAAAGCGAGACGACGAAGAGGAGGACACGGGCAACGGAGAAGCGGCAAAGGGCAAGAGAGATCCGGCCATCTTCT
TGCTGCAGGCGCTTTCGGCATACAAGAGAGGAGCGGCGATCGCGCGTGAAAACTGGCGGATCTGGGACAATGTAGTGACG
CTGGCATCGCGGGTGCGGCCGCCAGCAGTGGGCGACATTGTGATCGCAGTGCGGAACATACTATCGATCCGGGCAACGGA
GGAGGCAGTGGATGCAGATGTGGTGCGGCTTCTGCTACACGAAGCGGTGCTGCCGAAGCCAAAGCCAGCGGGCGGCGTGC
CTGGACGGGGGACGATGGAGAAGGCCGTATGCGAACTGGTGGAGATCGAGATTGTGCCTCTGATCACGACACGCAGCGAG
CTGTGGGAGCTGGTGACACGCGAGAGGGTGTGGCGAGGCGACCTAGCCGGAGCCATCGATGCGGCCGAGAAGGGCTGGCG
GGCAGCAACGGGAGGAGTCAGCGTCGGCAGCAGTCTGGGAGCAGCAGCTGTACGCACAGGAGGCGGTGGTGGCAGCAGCA
GCGATGAGGCCAGGAACTGGCTCGAGAACGCAGAGGCCTGGGACAGTGTCGTGGCTCGGACAGACGAACTGGTGTCGATT
CTGGAGAACTACGGCCCAGATGTACCGACAGTCGGCAGTCGGTGGAAGATCAAGGCACGGAGTGCCCTACGAAGCGTCAT
GAGCAAGGGAAAGGACCAGTGGGAGGGCAGTTCTGGATGGTCTACGCTTGAGGGGCTGCTAGAAGGACTGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62