GenePrediction:GLEAN_6654 Details

Name: GLEAN_6654
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:886507..884121 (- strand)
Length: 2387
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:886507..886471 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_156:886411..884121 (- strand)
Length: 2291
>GLEAN_6654 class=GenePrediction position=GCSC_156:886507..884121 (- strand)
ATGGCAGCCTACAAGACCCAGCCGGCGCAGCTGCATAGTACGTCTCAGGACAACTGCTTACATTTTTGCAGGATGAAGCT
CACTCTTTCTCTATAGGCTTCACAGATGCTGCGTACGCGCCTTACAGCTCACAGTCCTTTCAGCCACAACAAGCAGACAA
TACGGCATCACAGCTTGACGGCCTAGCCTTCGCAGCAAATGGAGCTGCTACGCAGTACCTGAACTCGGAAACAAACTCAT
CACCTGTGAACATCATTTCGTGTTCCCCTAACGCCGGGTCAGCTGGGACGCGCGTGGAGCTCAAGGTCACCAGCCAGTAT
GACCTCATGGCTATGTCGGCACAGGCACCATACATCTGGCTATCCTTCGGTTCGCAGAGGTGTCACGCAGAAGCCGTCAA
GGAAGGCATAACGCACGATGGCGTTTCCGTCTCTTATATTGTTTCGGCAGAGGCACCTCAGTTTATAATGACCAACTGCG
CCTCACAGAGTAATGTGCTACTGACACTCATCATTGAGAATACCAATTGTGAAGAGGTGGCGCGTGTTCCTGTGGCACAG
TCATTTTCTTACCATGACTCTTCTATCAACACGACTTCTTCCATGGGGGGGACAGCGGATAATGTAACAGCTGGCGCACC
TGAAGACATCACGCGAAAATCGCCAGCCGAGTCACCTGGACACGGCGAGAGTCCACCGCAGCTGACCGCACGAACATCGA
CAACAAGCAGCCCACACGAGGCACATAACCCGCTATCAACAGACTCGAATACTAATACGTTTTCCTACCCACACAACACT
GTCGACGCCGCTACTGCTGCCGCCGCCGCAGCACAACAGGTCCAACAAGCTCAAACAAACTTTGCAGCAGCTGCTGCCGC
CGCATCCAGCTACAGCCAAGACAACAGCAACATGCTCGGAGCATACCGCAGCGCGTCATTCTCGGACGGATTCCAACGCC
ATGCGGGTCCGCCTCCGCTGCGGAATTCCATCTGGAATGGCTACAGCAACAGCATCAGCCACCAAGGACATCATCCCCAC
GACCGCTACGGTAGCATCGCGCGCAATGACTCCATCACACAAGGCCACAGCACGGCGTCCATCACTCGGCCGTCACTCCA
TGGAGCACTTTCAGCACCCGGGAGCTCCAACGTGCCTCAACTAATCCGAACCAGCACTATCCAGAGCGGCTCGCCAGGAT
TGGGAGTTGGGGGTGTTAGCGGCTATGGTAATGGTCACTGGGGAAGCTACTCGACGAAGGCGGTCTTGTCTATCTTGGGC
AATCTCGACTCTATGGCACAGGAGTGGACTCCGGAAGAGTGGAATAGCCGGCGACGAATCGTACTCTTCCACAAGAAGCA
GAACGGCTGCCACTTGGAAGCCACATTCCGTGCAGTACCGATCAACGAGCGCCCACCCAACAGCATATGCATCAGCTGCA
TCTACTGGGCGGAGAAGCAGGAGTGCTTTGTCACGTCTGTTGACACGATAAACCTACTGGAGCAGCTTGTTGCTCAGCCT
TCTCGCTTTTCCGTGGAGGAGAAAAACCGGATTCGCCGCAATCTGGAGGGATTCAAACCCGTGACTGTCAGCAAGGCAAA
GACCGAGAGTGAGGAATTTTTCAAGCTGATCATGGGTTTTGGTGCGCCAAAGCCGCGCACGATCGAGAAGGATGTGAAGG
TGTTCCCATGGAAGATTTTGGGTCAGGCGCTCAAAAAGATAATTTCCAAGTATAGCGCGAGCCCTTCGTCGATTTTACCG
CACTCTAGCTCGGGGTCGGCTTCCAACCATCACATGCTGACCCCGGTCACGATGAGCCCGTCGTATGCGGGTCTACCCCC
TACACCGGGATCCGTGTCAGCGGGAACAGATGGAACATCCAACGTCGGCTACATGACTGTTGCTACTGGTCCAACGCCGT
CTGAAAGTCTCGCTAGTCCAAGATCGCTATCGGGGACTTCGGCGACATGGATGTCCTATGCCCAGGGACCATCAGGCCGT
CCTATCTCTCCTGGAACGACAATATCAAAGCCGCAATCCCCATCAACCGTGGGTCTGCGAATGAGCGCTTTGCCCACAGC
ATATGACAGCAGGGGAGCGGCGAATGTGACACATGGGATGCCCCCTGCTTCGCAAGCCTACGGTATGCACCACCACCAAA
CACACAATTTCAATTCTCCTCTTCCAGTGACCACAGCCTCTGGCGGTTCGACTGCAACACATACCACTTCGTCTGCCACT
AGCCACGGTGTGCACAACAGTAATGGCCGCTGGGACACATACGATGTGACCAACTCGGGACAATCCTACTCCAATGGCCA
TCATCAGCACGGTCATCATACCCAACTGTACGCCGGGCACTATGGAGACGGCGGTCAACGTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62