GenePrediction:GLEAN_6656 Details

Name: GLEAN_6656
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:872423..870757 (- strand)
Length: 1667
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:872423..872280 (- strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_156:872168..871790 (- strand)
Length: 379
Type: CDS
Source: GLEAN
Position: GCSC_156:871725..871379 (- strand)
Length: 347
Type: CDS
Source: GLEAN
Position: GCSC_156:871319..870858 (- strand)
Length: 462
Type: CDS
Source: GLEAN
Position: GCSC_156:870798..870757 (- strand)
Length: 42
>GLEAN_6656 class=GenePrediction position=GCSC_156:872423..870757 (- strand)
ATGGCGAAACCTCGCAGAGGAGTCCGGTTTCCGAACCGCGCAAACGGCCATGCCGAGCGCCGCTCCAGCTTCAGCGACGT
CAGTGAAGACGACGGCTCGTCGCCCAAGTCCAAGAACGGCGCTTCCGCTGGCGGCATCGTGGAGGTGCGCGATCCTGCTT
GACGGAGCGGCCGTTGTGCCCTGTCGGCCCCCCCGTTAGAACAAGGAACAAGAACAGATGTGATGCTGACAATGGCCCTG
CTGGCTCGCGAACAGAAACCGACTGCCGCACAGGAACAGGCGGCCGAGTACGAGAAGAAGAAGCAGAACTTCATCACCCG
CACCTTCTGGACCTTTGTCATGATCGGCGGCTTCTTCGCCGCTCTCTTCATGGGCCACATCTACATGGTCATCATCGTCA
CCGGCGTCCAGGTCGTCTCCTTCTCCGAAGTCATCGCCATTGCCAATGTCCCCAGCCGAGCTCGCCAGCTGCACTCGACC
AAGAGCCTCAACTGGTACTGGCTGGCCACCACCATGTACTTTCTCTACGGCGAGAGCGTCATCTACTACTTCAAGCACAT
TGTCCTGGTCGACAAGGTCCTGCTGCCCCTGGCAACCCACCATCGCTTCATTAGCTTTGTCCTCTATGTCATCGGTAGGC
CCGCCCCCCGATCCCGTGTCCCCTCTGACCTCTCGGCTGACCGGCCGGGTCCTCACAGGCTTCGTCTTCTTTGTCATGTC
CCTCCAGGCCGGCCACTACAAGTTCCAGTTCACAAACTTTGCCTGGACCCACATGGCTCTCTACCTCATCGTCGTCCAGG
CCCATTTTGTCATGAACAACATCTTCGAGGGCATGATCTGGTTCTTCCTGCCCGCCTCGCTCGTCATCACCAACGATATC
TTTGCCTACGTCTGCGGCATCACCTTTGGCCGCACCCAGCTGATCAAGCTTTCGCCCAAGAAGACCGTCGAGGGCTTCCT
CGGCGCCTGGATCATGACTGTTTTCTCCTCCTTCATCCTGACCACCATCCTTACTAAGAGCAAATATTTTATCTGCCCCG
TCAACGTTCGTGCTCCCTTGTTGCTTCTGTCTTGTATGTGTCTCGCTTTGCTGACCGGCTCCAGGATCTGGGCGCAAGCT
TCTTCACCGGCCTTGAGTGCGACATCAACCCCGTCTTCCTTCCCCACACCTACACCCTCCCGCATTTCTTCTTCCTGCCC
GACAGCTACTACCTGGCCAGCGTCACCTTTGCGCCCATCCACTTCCACTCGGCCATCCTGGCCACCTTTGCCTCCCTGAT
TGCGCCGTTTGGTGGCTTCTTCGCCTCTGGCCTGAAGCGCACGTTCAAGATCAAGGACTTTGGTCACTCCATCCCCGGCC
ACGGCGGTATGACCGACCGCATGGACTGCCAATTCATCATGGGCTTCTTTGCCTACCTATACTACCACTCCTTTATTGCC
ACGCACAAGGCCAGCGTCGGTAGGGTCCTGGAGCTGGCCATCACTGGCCTGACGCCCAAGGAGCAGGTCGAGCTCCTTCG
TGGCGTTGGCCATTATCTGCGGAATCAGGGCATTATCGGCGAAGAGGTACGAGATTCTCGCTTCCAACGGTCCCGGCTTT
GCGTTTCTATACTAACTCGAAGCAGGTACTGTCCTGTCTGGAAGTCACACTCCCCGCAAAGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62