GenePrediction:GLEAN_6657 Details

Name: GLEAN_6657
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:864837..864045 (- strand)
Length: 793
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:864837..864781 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_156:864715..864691 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_156:864634..864350 (- strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_156:864245..864209 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_156:864117..864045 (- strand)
Length: 73
>GLEAN_6657 class=GenePrediction position=GCSC_156:864837..864045 (- strand)
ATGGCACAAAAAATACCATCAAACTTCGATGCCGAAAATGCTGACAACTTCGAGGATGTAAGTGCGCATGAGCCCCGCTT
CCTTTGCTTTGGTCCGCAGCAGAGACTGACCAGACGTTCTAGATCGAGAAGCAGTTTGCTGTCAAGGGTAAGTGCAAGCG
ACAGTCTATGCAAATTGGTGAACCTCCCTGCTGACCAGCCCAGCTGTCCAACACATGGAGACATACTGGGCCATCCTGGA
ACGTGTCCGCGGCTCGACGCTGCGCTTGACCAAGATGGACGACGACATTCATGAGCACCTGGCAAAGGATTTTCCTGATT
TTGACCCATCCGAGACGGTCGACGAGGACAACATGAAGAGCAAGGAAGGCAAGGAACGGTGGCGGAAGTTCATGATGGCC
TACGAAAAGAAGGTGGACGACTACAACTTTGGCACCATGCTCCGGTCAAACCCGAAGTGGGAATACGACCAGGACACAAC
CATCTTTGGTGAGTGATGGCATTCGAAATCGTGTGGTACTTTCAAAGAAAGTGCACGAGCCACTGATTCCCAACACGGTG
CTTATGTTCCGCGTGCTAACCAACATCGCCAGTTCCGAGAATGCAGTTCTATGCCGTCGAAATTGCAAGGTAAGGGACTC
TACCAACGTGAAAGGCATTCCTTGCCGTCTCCCTGCATCTCCCCCTTCTTCTTTCACTCGTTTTCGCTAACCATCACCAG
GAACCGGAAAGGGCTCAACGACTGGATTTATGAAAAGGCGCAGGCCGCCAAGTCCGGAAGCAACAAGAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62