GenePrediction:GLEAN_6658 Details

Name: GLEAN_6658
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:863339..858925 (- strand)
Length: 4415
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:863339..862863 (- strand)
Length: 477
Type: CDS
Source: GLEAN
Position: GCSC_156:862779..862159 (- strand)
Length: 621
Type: CDS
Source: GLEAN
Position: GCSC_156:862077..858925 (- strand)
Length: 3153
>GLEAN_6658 class=GenePrediction position=GCSC_156:863339..858925 (- strand)
ATGGAACCAGTCACAGAGTCGTTGCCTCTAGAGAATCTTCACACAACAGGACCGGCAGGAGACCATGCGGCCAGCGTGCA
GCATCTCTTCGTAGCATGGACATGCGGCGAGCTATCGATCCTCGTTCCAGCCGTTGCAGCTTCGGCTGTTGTTGCAGGTG
CAAAGACTGCCTATGCTCTCATCCTCGGCGAGATATTCCAGACGATCAGCGACTTTGGAAGCGGTCGTGTGAGTGTCCAT
GACACTGTGCGTACCATTTCAACGTGGTGTCTAGGCCTTGTCGGGCTAGGGGCTGGCAAGGCCCTGATTTCCTTCTTGAT
GATGGTGATGTGGATAACCCACGGCGAGTCTCGTGCACGAAGCGTGCGACTACAGCTTTTCCAGTCGCTTCTGGAAAAGG
AAATGGCGTGGTTCGATACACGACGCGGCGGCATGTCGAGTCTGATGACCGAACAAAACACGCAAGTCCTAGCCTCAGTG
TGGACAAGTTAAAGCAGACAGCTCGGTACTAACCTGCATCGTCCAGCCAAATCCGGGACTTGCAAGTCGCCACATCGCAG
CTAATGGGCGTCCTCGTCACCGACTGTGTCGTCTGTGTGGCCTGCCTCGTCGTGGCCCTTGTCAAATCATGGAAGCTGAC
CTTGGGTCTGCTCGCGTCCGTGCCTATCGCCGTCTTCGTACTCAGCTTCCTTGGCCGCGGCCTCAACCCGGCTGCAGAGA
AGCAACGGGAAATGCTCAACCAGGCTGCCAAGCACGCTACAGCAGCACTGGTAGCCATCGATCTGGTCAAGGTGTATGAT
GGCCACGATACGGTGATGTGGCAATACCTCAGCAGCATCCGACTCGCTGCACATTTTTACATAAAGCAGGCCCTGAGTGC
ATGCTTCCAAATGGGCTTCGTCAAACTCTGGATGGTCAACCTGTTTGTTATCGGGTTCTGGTTTGGCATGATATTGGTTG
GCAAGGGCCAAGCCACTGCTGGCAATGTCCTGACGGCATTCTATGCCGTTCTCATTGCATTCCAATCGATTGAGGCGCTG
GGCACCCAATGGGTATCCGTCCTCAAAGGGACTGTATCAGGAAAGGCCTTGGAAGACATGATCTTCTCCGGATCTCAATC
CGCACTGCTGTTCTCGAAGTCACAACCCAGCAGAGCCCCAGGAGGCATCGAGCTTTCTAATGTAGGTTGACAGGCTCGAT
TCCTAGTCCCTTTGAAGCGGATTTGATCAAGTTGCTGACTTTATTTTCTTCGCTCCATCTAGGTCAGCTTTGCGTACCCT
TCCAATCCGAACAAGACCGTCTTAAAGGACTGCTCTATGCTATTTCCTTCTGGGCAGGTTTCCTTTGTCGTCGGGCGCAG
CGGATCCGGAAAAAGCACCATCGCCGATCTTCTTGTGCGGTTTTACCATCCCACGGCCGGACGCATTCTTGTTGACAAAA
GCCCCATTGAAGAGCTGGATGTTCGCTGGCTGCGCGAGAACGTTTCCCTGATTCAACAATCCAGCACCGTTTTTAATGGC
ACGTTTGGCTGGAACGTGTCTCTGGGCAGTTCCACGCCTGATTCCATAAACGAGTCCAGTATTAAGACGGCCTGCCAGAC
TGCTCTGCTGCAGTCGACCATCGCCGGATTACCACAGGGACTGGACACTGTCGTCGGCCCACGCGGAGTCGCCCTAAGCG
GTGGCCAGCGACAGAGGCTGGCTGTGGCCCGGGCAAAGATCCGTGATCCTGCCGTCTTAGTATTAGACGAGACAACAAGC
GGGCTCGACCCGAAGAGTGCACAGATGGTACTAGAAGCAGTGCGCATCTGGCGGCGAGAGAAGACGACAGTCATCATCAC
ACACGACATCTCGAATATCGCAATGGAAGACTATGTGTATGTTATGGATTGTGGCAGTCTAGTGCAACAGGGGCCATATT
TCCAGCTGGCTAAAGATAGCGGAGGCATGCTGGATACTCTTCTGAATGCGGTAGCCGTGGGCGGAGCTAGAGATGTCGCT
ACTGCATGTCTGAGCCCTGTCGAAAAAATTGGACATGATCAATTTGGGCATGGCAACCAAGAAGATGGTGTTGACGATCA
GCTAGCCGCAGTCGGAGGAAACCAAGCCGATGAGCCGGCCATTATGGCATGGCCGCTACCACAAACATGGCGAGGCAGCT
CCTTTGGCGCAGGACCGTTTCTGGCATCTTCAGCTGCACATGGTAACTTCATACACCGGCTTTCATTGCAGTCCGCCCAA
GCAAGCCATGCTGTCAACTGGCCGCTCCCAGCTCCGGAGCCCACCTTGAAAGCCAAAGAGAGCCCGAAATCTATCGAATC
GCGATCTAGCGTCGATCTGGTTTGTGACCAGGGTCACCAGGCTCAGGCGAATCGACAGAGCTGGAACGAATCTGGGCAGC
GGCAAAGACAAGCGGTGGCATTGACCAGAAAACGGGCGCTGAGCTCCACCAGTTGTGACCGTGAAACGAGTCCCCCGAAA
CCAAAGCCCGCGATTCCAACGCTTCTGACAGTTCTTCGGACGGTATGGCCGCTCCTCGGCAAGGCCAACCGTATCGAGGC
CATTCTGGGCCTTTTGTGTTGCATAGTCGTGGCCGGCAGCAATCCGGGATTCTCGTTTGTGTTCGCACGGATGCTCGAAT
CGTTCTGGTCTCCCAAAGCCAACAAGGAGGCCGTGGGAAGACCGTGGGCGCTCATTCTCATCGGACTTTCTATCGTCGAC
GGTTCTGCCGTATTTGGGTCGTTCTACTTGGCCGAGCGGGTAGGCCAGACCTGGGTCAATGCGCTGCGAAGCGAGGCTCT
GACACGGCTGATGCGGCAGCCCAGGTCGTGGTGGTCCGCTTCCGATCCAGAGGCAGGACAAGACGGTGAGTCTCCCTCTC
CCAGCCGAATCGTGGAGTGTCTCGACCGAGGCGGAGAGGAGATGCGCAAGCTCGTGAGCGTGTTTGTGCCGATCCTGACC
ATGGCTGCGGGAATGGTGATCACATCGGTGGGCTGGTCGCTCGCTGTGTCGTGGAGGCTCACGCTCGTAGCCCTGGCCAG
TGGGCCGATCATTGTGAGTGTCACGCATCTGGCATCCCGTGTCAGCAACAAGTGGGAGTCACGGTCGAACTGGGCGGCCG
AGACTGTCAGCGGGGTGTTCAGCGAAGTGTTTCCCGATATCCGAGTCGTGCGGGCTCTGACACTGGAGACACATTTCTCT
GGAAGACTGGCTGTGACAGTGCAAAAAGCATTTCGAACGGGCCTGTCGCGTGCTTGGCGCACGGGGATTTTGTATGGCCT
CAACCAGGCGCTTTCGGACTGGCTGACGGCTCTGGTTTTCTACTATGGCGTCAGCCTGCTGACATCTGGCGATGGCGCCC
GGATATCGGTGTCCGACGTCGTCCAGGTCGTCAATCTGCTGCTGTTCAGTATCGGCTCGGCCGCGTCCCTTTTGAGCAAC
GTCCCCCAAATAGCAGCTTCCAAAGCTGTGGCTGCGCAAATATTGGAATATGCCAGCCTATCTCTGCACGCAAGCCATGA
GCACTCGCGCATAGTCCTTGCTCGGCCAAAGAAGTTGTTCCCCGTTCGGATGGATGGCCTTGTGTTCCGATACCCTGGAA
AGGAGGCGAGAGCTGTCGGAGACAGTTTCAATTCCCTGCAGCCAGCCATTCTGCACGGCATCAACCTGGAGATACGTGTC
GACGACTTTGTGGCCATTGTGGGAACCTCAGGCAGTGGGAAGAGCACCATCCTGTCGCTGCTTCTGCGCCTATATGAAAG
CGATAAAGGCAACCAGCTCACATTTGACGGAATGCCTGCAGACCAGCTGGATACCAAGGCGGTTCGTTCGCGCATGGCCT
ATGTGCCCCAGCACCCCTATCTGTTCCCGGCGTCGGTCCGGGCTAATATTACCTATGGCTTGGATGAAGCATCGCCATTG
TGCCAGGCAACTTGTGTGGCCGATGCTGCACGAGCCGCCAGCATTGACACATTTGTGTCATCCCTCACCCAAGGATATGA
CACAGTTGTGGGCGACGTCGTGGGAGAGGAGACGTCCGGTGAGAATGCCGGTGGGACTGGCAACGGCCCTTGCAGTTCAA
CGAATGGTTCGATGTCTTCTCTGTCCGGCGGCCAGGCCCAGCGAGTATGCATTGCTCGAGCGCTGCTGCGACGGCCACAA
CTGCTGGTGCTCGACGAGCCGACCAGCTCACTGGACGCGGAGTCGGCGCAGATCATCCGGACGGCATTGCGAGGACTCGC
AGACCTTGGAAGCGGAAGATCCATTGTGGTCGCTACGCACTCCAAAGCGATGATGCGTCTTTGTGACAGGGTGGTGGTAG
TGCAGGATGGTACGGTGGTGACCAGTGGGCCGTACGCGGAGTTGTTGCAGCACGACGAGACGTTTGCGAGGCTGGTGGGT
GAATATGACGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62