GenePrediction:GLEAN_665 Details

Name: GLEAN_665
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1285612..1287380 (+ strand)
Length: 1769
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1285612..1285851 (+ strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_97:1286194..1286500 (+ strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_97:1286572..1287217 (+ strand)
Length: 646
Type: CDS
Source: GLEAN
Position: GCSC_97:1287323..1287380 (+ strand)
Length: 58
>GLEAN_665 class=GenePrediction position=GCSC_97:1285612..1287380 (+ strand)
ATGAAGTTTGAGTACGACGGCCGAGGCACGAGTGACGACGGTGCTGGGCCGAATGGAGAGGAAGCCGACGAGGTAAACCG
CCTCGACGCGATGACGGGCGAATACGTGCACGGAGACAGCGGCGCCGGCGATGTGGCGGTCGACAGCGCGATGCTCGACC
TGCACGACGCGGCCATGGACGACAAGAGCGGAGCGCGGCCGCTGGGTGACGGCGCGAATGAGGTGGATGAGCTGTCGGTC
GTGGACGCAGTCGCAGATGGCGGCGAAGATGGCAGCAGCGGCAACGACGACGGCGTCGTGGTCATGGACATGTCGGCAGC
AGCGGCAGCGGCAGCTGTGGCAGCAGTCGCGGCCAAAGCAGTTGCGGCAGCATCCAGTGCGGGAGATGCGCACCCGAACA
GCGAGAAGGACGAGAAGGGCGAGGAGGAGGACGGCAACAGCGGCAACGATGACAATCCGATGGCACAAAACAGTCTACGA
CTGACGCAGACCATGACTGCCTCAGCAACCACAGCAACCACAACAACCACAGCAATAGCAGCAACAACAGCAGCAGCAGA
AACGACGCCCATCAACACGGAGCGCATGGCCGTGGACTCGGGCTACGACCGGCTGCTGATCGAGAGCGCGCTGGCCAAGC
GGCTGGCCCGCGAGCCGGCCCTCCGTCCGGCACAGCAGCGTCGACCGGAGCAGCAGCTCAACCTGGCGCGGCGCAGCAAC
GTCGAGGCTCTGTTTGCCCACATTGCCGGCGAGGCCGCCGCGGTGCCGTGCAAGAACTGCCACAAGGGCCACGGCCCGTG
GACGGCCTGCGTCGTCGTCGATGGCCAGATGTGCGGCAGCTGCGCAAATTGCTGGTTCAACGCGTCCGGGGCGCGTTGTT
CTTTTCACGGTGGGGTTTCTTCTTTCTTTCTTTCTCTCCTTTCTTATTTTCTTCCTCCCCCTTTCTCTAACAAAATCCAG
AAGCCAAGACACCTATGCAACCTGGCCATCACTTACACCAGCGGCATCACCTCTCGTCCGGCGGAAGTGCCTCTCTGGCC
TCGTCCACACCCATCGATCCGCGCCTGTCGCATCCCGCATTGTTTGGTGGCGTCGACGCTGCCTCCCTCGGACTGGCGCA
CTCCCACCGCTCGGCTGCCGGCTCGCTGCATCCTCATACGCAGCCTCACCCATCACCAACGGCGGCCACGACCGCCTCTG
CATCCACGGCCGCCGCTGCTGCAGCCGCTGCCGTGGCCGCTGCCGTGCAGCATATCCACAACAGCAGCAACAACAACAGC
GACAGCGCCAGCGGCAACAACGGCGTCCATGTTGGCGCCCATCACGACATGGTCGGCGACGCCTTTGGCGGCTTCGGCCT
CCACCTGGCAGCGGCCATCCTGGGCGAAGACGTAAGTGGCAACGGCGCCGTCCGAGGCGACTCGGCCGAGCTGGGCGCAG
GCTCCACGGCAGCTGGCAGCACTGCAGGTCCGGCCGGAGTGGACTCGTCCCTGATCGGCTTCGTGGTCGATCAGGCGCTG
GCCGAGGTGCGGAATGCCGATCGGCGAGCTCGTGACCTCATGATGGTGGAAATTGCCGCAAAGCAGCTGGCGCTGGCTAT
TGTGCGGTACGGAGAGAGCGAAAGACAGAGCCAACAGCAGCAGCAGCAGCAGCAACAACAACAGCAACAACAGCAGCAGG
CGGTTTTGGCCCTGGCACAACAAACTGGCAGCGGTAACGTTGACAGTGCAACAGATATCAGCAACCGGGGCTCTTCAGAC
GACATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62