GenePrediction:GLEAN_6662 Details

Name: GLEAN_6662
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:844609..842805 (- strand)
Length: 1805
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:844609..844504 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_156:844404..843095 (- strand)
Length: 1310
Type: CDS
Source: GLEAN
Position: GCSC_156:843035..842805 (- strand)
Length: 231
>GLEAN_6662 class=GenePrediction position=GCSC_156:844609..842805 (- strand)
ATGGTGGTCGACACGGCATACTACGACCAGCTGGGCGTTTCGCCGACGGCGACGGAGCTCGAGATCAAGAAGGCATACCG
CAAGCAGGCGATTGTTCACCATCCAGGTTAGCAACCACATCTTTCTTTTTTTGCTTCCTCGGAATCGTCCCTGTTGCCGC
CTCCTCCGCCTTCTCCTCTTTTCCCCACTGACACTTTTGATGCAGATAAGAATCCAAACGATCCGACAGCGCACGAAAAG
TTCCAGGCTATCGGCGAAGCGTACCAGGTGCTCTCAGACCCAGACTTACGGAAAGCCTACGACAAGTACGGCAAGGATGC
ATCGCAACCCAGTGAGGGGTTTGTCGACCCGGCGGAGTTTTTTACCAGCATCTTTGGCGGGGACGCATTTGCCGACTGGA
TTGGCGAGATATCTCTCATGAAGGATCTGACAGCTACGATGGACATTGCTGGGACAGCTGAGGAGGGCGAAGAGGGCTCC
GCCACCGCCGAGGACGGCGAGTTTCCCGGCACCGAGGAGGCGATGAAGGAGAGTGAGAACGCGGCCGGGGAAGAGCACAC
AGCGGTGGCTGCGTCGGCTACCGATAGCGATGCGGGTGCGGCCAAGCCAGCCGCTGTGGTGGTGGAGGACGAAAAGGACA
GCGGAGCGACGGCGGCATCGTCGGAACCCAGGAAGCCTGTCGCCGAACCGCCTGCAGCAAAAGCGTCACCTCCCTCGGGC
CGGACATCGCCGCTGCCCACGGGCTCTGGCCAGAGCACGCCGGGTGGGCGCAAGATGCTTCCGATTCGACCGGCACTGCC
AGAGCGGCCGCACTCGGAAACGGGCGGCCCGTCGGCGATGGCCGGCAGTGAGGACGATAGCAAGGACATGAAGAAGAAGG
ACAAGAAGAAGGCGGGTTTGTCGAAGGAGCAGCGCGAGCACCTGGCAGCATACGAGCGCGAGCGGGCGCGGATTCGACAG
GAACGGGTGGACATGCTGGTGCGCAAGCTGCTGGACCGGGTGTCGCTGTGGACGGAGACGGACAAGGGCCGGGACGTGAC
CCGGTCATTCCAGGAGAAGATCCGGCTGGAGGTGGAGGAGCTCAAGATGGAATCGTTTGGACTGGACATTCTGCACGCGA
TCGGACACACGTACGTGAGCAAGGCGACGGCGGTGCTTCGTAGCCAGAAGCTCTTCGGCATGGGCGGATTCTTTAGCCGG
ATCCGCGACAAGGGCACGCTTGTGAAGGAGACGTGGAACACGATCAGCTCGGCTATTGACGCGCAGCAGACGATGGAAGA
GATGGCGCGGATGGAGGAGCGCGGCGGCGAGGAGTGGACGGACGAGAAGAAGACGGAGTACGAGCGGCGGGTGACGGGCA
AGATCCTGACGGCGGCGTGGCGCGGCAGCAAGTTTGAGATCCAGAGCGTGCTGCGCGACGTGTGCGACGCGGTGTTGAAC
GACAAGAAGGTGCACCTGTCGAAGCGGCTGGAGCGGGCGGAGGCTCTGGTGCTCATCGGTGACATTTGCAACAGGGTGAG
TTTTTTTTCTTTGTGCACTTTCTGACCTCGCGAGACCACAAACTGATTGTTCAGGCACAACGAACTCCGGAAGAGGAAGG
CGACTACATGGCGTTTGAGCAGCTCGTGGCCGAGGCGGCCATCAAGAAGGACAAGGAGTCGAAGAAGAAGGAGAAGAGCC
GAGATCGTCGCAGCACATGGATCCACAAGGCGGGCGAGACATCGAGCGGCGAGGCTGGGGCAGAGGCGCATATGGCGTCG
GCGGCGGAAACGGCAGCAGACCTCCCGAACGTGCCGAAAGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62