GenePrediction:GLEAN_6664 Details

Name: GLEAN_6664
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:833482..830224 (- strand)
Length: 3259
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:833482..833408 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_156:833356..833194 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_156:833131..832180 (- strand)
Length: 952
Type: CDS
Source: GLEAN
Position: GCSC_156:831991..830224 (- strand)
Length: 1768
>GLEAN_6664 class=GenePrediction position=GCSC_156:833482..830224 (- strand)
ATGCAGCGCAAGCCAGTCTTCACGGCCATGGCCGTCTTTCTGTCGGCCGTCCAGGGCCTCAACATTCTCATCACGGTGAG
CTGACACGACATACAAGGTCCGTGTCGGTCGTGCTGACCGCTGCAGAACGACGATGGCTTCGGCTCGGCCAACATCCGGG
CCATGTACAAGGCCGTCAAGGACCTAGGCCACGACGCCTACATTGTGGCCTCCAGCAGCGACATGTCCGGTCAGGGCGGC
CGCTCCGCCTACACGACCGAGGCCAATCTCACGGCCGACTCAGAGTGGGGTGTGTTCTGTTGTTGGTCGACTTCGAGGTC
GTGGTGACGCCAGCTGCTGACCAGTGCACAGGGATCGTCAAGGCCGGCGCGCCATCGATCGGCCAGGACCCCAAAGACAG
TCACATCTGGTACTACAATGGCACGCCGGCAGCACAGGTGTTCGTGGCGCTGGACCACGTGCTGCCGCTCTTTGGCAGCT
TCAGCAAGCCGGACCTGGTGCTGGCGGGGCCCAACGTGGGCCTCAACCTGGGCCCGTTCCTGTACACGCTCTCGGGCACG
ATGGGGGCGACCTATGCGGCCGTGGATCGTGGCATTCCGGCTATCTCCTTCTCGGCTGCCTACAGCCGGCAGACGCCCTA
CTACTGGACCAACACGTCGACCCTGGCCGGGCTGCAGGACCCTGCTACGATTGCCGGCCGGCTGGCTGCCGCCCTGGCAC
AGGCCTTTATCGACAAGGCGGCTGGGGGGCGCATCCTGCCGGTGGGCTACGGCATCAACGTGAATCTGCCGTACATCACC
AGCTTCAGCAACGACTCGTGCGTGAACCCGCCGTTTGTCCTGACACGCATGTCGGGCGGCGCCGACGTCGACAAGGCCGT
GTACAACGCCACGACAGGCCTGTTTCACTACGGCGACCTGGACGAGGCTGGCTCGGGCGTCAATGCCTGCATCAACGGCG
ACTGCAGCCTGCCGGGCGAGACAGACGTTGTCAGCGGCCATGGGGCGTGCCAGGCGTCAGTCAGCGTCTTCACCGTCGAC
TACGACGCACCATACACTGCCAGCAGAAGCAATGCGACGATCGGCAATCCGTATGCGCTGGTGCCTGGCATAGTGCAGCT
GCAGAACGCCAGCAGGCTGGTCGGCGGCCTGGGTGCCAATGCTACTGTCCGGGGTGTCAGCGGAAGCCCGAGCACGACTG
TCGGGAGCTCGCCCAGGGCGTCGACGTCGGCCGTGATCAGCTCGGCCTCGGACATTCGGCTGTCGGTGGCCATGCTGCTG
GGCTTCTTGGTAGCAGCACTGATGTAGGAATAGGCGGCAGATATGAATAGCAGAGGCATCAGGACAGATAGAACAACGTC
TAGTCATTCGTCTATTGTATGCTCCTTGTCTTGTCTGCTCATAACACTGTATATGATGTAGAATCAAATGCTTAGTGATT
CATGATGTGCCCACGTGACACTGGATCTTGCTTATCTTCCGCGTTAGCCAGGCACATGACGTCAAAGATGGCCGAGGCCC
AGGGCAGCCAATCAGACAATTCCAGCCCCGCTTTAGCCAACTGTACGGATAAGCAACAAAAGGGAACGAGTATCCCCATC
GCTGCGGATGCCGGCTGGAGCCCGTCCCGGCCCCATCCTGTTTCTGTTTCCTTCCACGGTGCGTACTCTCGCGTACCCGG
AGCGCGTGTTGCCAGCGCAGTGCAGACGACGGACGACGAAGAGGGACGAACGAACGGTGGCACGGCAAAGCGGCGAAGTG
GCAGATACGGCCCAGTCCAGATTTGGTCTTGGAGCCCAGATCGACTGTCGGTCGTTTGCGGACGGCCACCCGCGACGGCC
ATGCTGCCCGACCCGAGCCTGACGGTGACGCTGCCGAGCTTACACGACGGCACGGTGCTGGACTGCCGCGTGTACCTGCC
ACCGGCGACGCTTTTGAAGGCTCAGACAGTCGAGACGACCAAGTCGGTCGATGCGCGGTGGCGGGGCCACGCGGCCGTGG
TAGCGCATCCGTACGCGCCGATGGGTGGCAGCTACAACGACGGGATCGTGCGCATGGTGGCTGACACGCTGCTGCAGCGG
CCAGCACAGCCGTTTGTGGTGGCGACGTTCAACTTCCGGGGCGCCGGCCGACGGCCGAGCGGCCACACGTCGTGGACGGC
ACGCGCAGAGACGGGCGACTACATGACCGTCGCCGGGTTCCTGTACTACTTTGTGCACCATCTGGACCCGTACGGCGACG
GCGGGCTGTCCGGGGGATCCACCCATCGGCCCCCCGTCTTCCTCTTTGCCGGCTACTCGTACGGGGCCATCGTGACCCGA
TTGCTGCCACCCATGGCTGACGTGCTCGCGCTGCTGGCTCGCCCCGATATTGACTCGCCGGCAGCCGAGGTCCGGCGACG
GGCGGCACGCTGGGCCGCGATGCAGAACGCCGACTTTGCTGAGCATCGATCAGCCTTGGTGGCCGCAGCCGAACGGGGCG
CCGACAGCCCACAGAAGAAGCTGGTGCGGAGAGCCCGCCTCAGCATGGGCATCCGCGTCGGTGGCAGTGAAGACAATAAC
AACAACAACAATAACAGCAACAACAACAACAGCAGCAGCAGCAACAGTCCACGGCGCTGCAGCCAAGAGGTCGCCCGGAC
CGTCAACACGGCCCTGATGGGAACCAGCAAGCTGCGGACACCAGCAGTTCCGGTGGCCAGAGGCAGTAACAGCAGCAGCA
GACCGTCGGCCGAAGGGCCCGTCACAGCTGTGGCTGACATCCGGGAAGAAGGCGACCGAGACGAAGACGACGAGATCGAC
ACGTCCAGACTGTCGGCATTGCCAAACCTGCCGGTATTTCGACCGTCATATCTGCTGGTATCGTTTCCAGCTGGCCTGGT
CACCAGTCTGGCCACGGTCTTCACCTTTCCGCCGTCCGAGGGCCCGACTTTGCCGCCGTCCGAGGCCAAGCTGGCTGACC
ACCCGACGCTGGCCGTCTATGGCGACGCCGACCGGTTCGTCTCCATGCGTCATATGCACCACTGGACTGCGCGCATGACG
ACCGCGTCAACAACCACTGCCGGGAAGACACCCGGCTTTCGCGCGCTCGAGGTCGCCGCCGCCGGCCACTTCTGGTCCGA
GGGCCGCTCGCTGTACGACTTGCGCGATGCTGTGAGCCGATTTGCCGACGAGCTGGTGGCTGGACCGCCGGCTGGAACGG
ATGGCGACGACGACGACAGAGAGAAGCGAAAGGGTGGTAATAGCACGAGTGTGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62