GenePrediction:GLEAN_6666 Details

Name: GLEAN_6666
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:823611..819459 (- strand)
Length: 4153
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:823611..823519 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_156:822199..820931 (- strand)
Length: 1269
Type: CDS
Source: GLEAN
Position: GCSC_156:820878..820709 (- strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_156:820602..819855 (- strand)
Length: 748
Type: CDS
Source: GLEAN
Position: GCSC_156:819786..819699 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_156:819649..819573 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_156:819515..819459 (- strand)
Length: 57
>GLEAN_6666 class=GenePrediction position=GCSC_156:823611..819459 (- strand)
ATGCCTGCCATGACCAGTACAGCCCTCTTCGTGCTCGATCTGCAAAACGGCATCCTGGCCCACTTCCCTGACACGACGGC
CTATCTGGAGCGTGTCGCGGCCACGATCGCGGCTGCAAGCGCGGCCACCCGGAGGTGTCGAGCCGCAATCGCGCGTTCGG
CCGCGTGGCCGCCTACAACGGTTTCGTCGAGGGCGACGACGCCGTGCTGCGCGGACTTGACGTCACCACGGCTGACAGCT
GGCTGGGCGAGATACGACATGCTTCGTAGGGAACAGTTTGCTGCGCCACGAATCACGTGACCGAAAAGCCACCTCCTTTC
TAGTCAGTGAGAGCAGAACTCCGTACATACGGAGTACTCCGTACAGCCTGCTAAGATAAGTGACGAGACGACCAATGCGA
ATTAGCAATCATTACGATGTGCTCCATACTTGGTGCACCATCCGCGTGTCTGCAACGGGAAGCTGGCTGCCTGGTGGGGC
ATGCGGCATGCTTCCTTCGTAACAAGCTTTCTGTCCCCTCGCCAAGGAACGCCAGAATGCCAAGAGCCCGCGGCCCGCGG
AGGTTTTTGGCGATGCCTCTTGGCAGCCTGTCATCACGATGGCCTGGACGGAGCTGTTGCGTGCTGCGATGCTGCGATGC
TGAGTGCCTTTCTTTGTAAATCATGACCTTTCTTTGACTGGACCCTGGACACCTCGGCTAGAGCGAATGCTCGCTGTTGC
CCGAAACCAGAAGGTCGTAGAGAAGGACACCCAAACCGGACGGCAGGACGGTAGCTGCAACCGCCCCAATCGCAAGATGC
TGACGCTCCACTCGGTCCTGGCCCATCGCATAGAGATTGCCGCGCAGTTCAGGTAGAGAAAGGAAAGTGTAAAAAGAGGA
GGGGAAAAAGGGAAAAGCCCGCGGCGAGTCCGACAAGTGGCCGAGAAAGGGAAGTGCGACAACGTCCGTCAAGACAACCT
TCTTCTTTGTCCACGACGGCATATGACCGTCCATGGTACTCGTACGCCTCTGCGGTCGCACATAGAGACACTCCGTCGTT
CCCAGGGACGACTTCGCAACGCCAGATTGGCTTGTTTTGCCGCTCAATGCAACGGTCCGTGCTGTTATCTGGCCCTGAAC
TGCCTGATAGACCGAATCCTGCTGGGGACGGCCGGTCCACCTTCCTGTACAGGGTAGCAGGGCTGTGCAGTCGTCCGGCT
ATACTGGCCAGACACCGGACGTGATCGGCAGCTTCGCCGCCGTCTGCAGCCACGTCGTGTCCTTATCTCTCCTCTGACAG
GACTGCTGCTTCTTCCGGCCTAGGCGAGCGTGACAGGCGTGTGCTGGCCGTGTGTGCGTATGTCAGACGCCGTACTCGTA
TATATACGCGCTCCTGTCGTGTGGCAGCACCAGCCGTCTGTCGTGGCCGTAGTTCTTCGCGCTGCAGAAGACGACAGACA
CGATGCCAGCCGATAGCGAGAAGACGGACAGCAAGACGGCGTCGCCGCACTTTGTCGACGTGGACGGCAGCTCGCTCGAG
CCCGAGGTCGGCGATGTGGTGACCACGACGATCCACGGCGGCGTCAAGACGACGGCCCGCGGCAACGACGGCTACCTGGA
CGCCGAGGTGGGCGACGTGCTGCCGGCAACGGCAGACGCCGCCGTCTCGACACCGCTGCAGCTCGTCACCAAGACGCTCG
ACTGCACCGACGACCCGAGCGAGAGCCCGTACACGTTCCGGGCCTTTGTGCTCGGACTCGGCCTGGCTGCCTTTGGTGCC
GTCATCGCCGAGATCTTTTACTTCAAGCCGCAGACGGTGACGGTCAACGCCATCTTCCTCGTCATCCTGGCATACTGCTT
CGGCGAGCTGACGACGTTTATCCCGCGCTGGGGCCCGGTCGGCCGCTTCCTCAACCCTGGCCCGTTCAACCAGAAGGAGC
ATGTGTTCATCGTCATCATGGCCAACTCGGCCTCGGTCTCGGCTCTCGGCACCGAACAGCTGGCCGTCCAGACGCTGTGG
TACAACGAGGAGCCCAACGCGGCCTCGGCCATCTTCATGCTGCTGTCGTCCCAGTGCATCGGCTACGGCATCATCGGTCT
GATGCGCAACATCTTCATCTACCCGACCAAGTTTGTCTGGCCGCTGTCGCTGCCGCTGGCCACTACCTTCCAGTCCATGC
ACCTCGACAAGGCCCTCGCCCGCAAGCGCCTCAAGGTCTTCTGGGCCGTCTGCATCTTCGTCATGATCTGGGAAATCGTG
CCCGAGTACATCTTTCCCCTGACAACCGGCATCTCCATCTTCTGTCTGGCCAACCAGCACTCCGAGCTCTTCACCTACCT
CTTTGGCGGCTCCAACGGCGACGAGGGCATGGGCTTCCTCAGCTGGTGCATGGACTGGCAGTATGTCGGCACCAGCCAGT
TTGTCTTGCCGCTCAACACCCTGCTCAACCAGCTGGTCGGCTACCTGCTCTGCGTCACCCTCACCATCGCCGCGTACTAC
GGCAATGTCTGGAACGCCAAGAACTTCCCCTTCCTCGCCCAGGACCTCTTCATCGCCAACGGCACCGACACCTACAACCA
GAGTGCCATCCTCGGTGCCCACAACAAGGTCGACCAGGCCAAACTGGCCGAGTACGGACTTCCGTGGTTTGCCACTAGCA
ACGCCCTCTCTTTGCTGACCATGAACATGGGCGTCACGGCTGTAAGTCGCACCCACCCCCTCTCGCGCGCACCCACACTG
ACTGACAAAATAGGGCGTCGTCCACATCTTCCTCTGGAACTGGTCCGACGTCGGCTTCATCTTTGACGTCTTCCGCCCGT
CCGAGCTAAAGAAGAGATTCGACTATATCAAGTCTGGAGCCATGCTGCGCTTCTGGAAGGACGACGGCAGCTATCCTCCG
GAGACATATCCGGGAACCGAGGGGTAAGTAAGAGAAGAGACACAAGAAGAACAAACAAAACAAAAAAACGAGCGCAGCGA
AAGAAAAAAAAAAGAAAAAAAGAAAGAAAGAAAGATGCTAACATCACAGCGACCCGCACTTCACGCTCATGCGGGCCTAC
AAGGAGGCGCCGACCTGGTGGTATCATGTGGTGCTCGTGCTCGCCATCGTCATCGGCATGATCTGCTGCTACCAGCAGAA
GACAGAGCTGCCGTGGTGGGCCTTCCTCATTGCCGTGCTGCTGTCGTGGTTCCTGTCCATCTTTTATGCGGCCATCTACG
GCATCACCGGCTTCTACTACCAGCCGACGACGGCGGTGCAGATGATTGGCGGCTACCTCCGGCCAGGCTACCCGGTGGCC
AACATGATGTTCACGCTGTACGGCTCCAACGGACTGGTCCAGGCCTTGTTGATGCTCGGTGACCTCAAGCTGGCCCACTA
CACCAAGCTGCCGCCGCGGGCTACCTTCCTCTCCCAGATGCTCGGCTCCATCCTCGGCGCCATCCTCAACTGGGTCATGA
TGAACGACATCGTCAAGGAGCACCGCGAAGTACTGCTCTCGGTCGAGGGCACGAACCTGTGGTCCGGCCAGAACGTGCAG
ACGTACAACGCCCAGGCCGTCGCCTGGGGCGGCGCCGGCGACAAGATCTTTGGCCGCCACGGCGAGTACTGGTATGTGCC
CATGGGCCTGCTGTTCGGCCTCTTCGTGCCGCTGCCCTTTTACCTGGTCCACCGCTTCTTCCCGAAGCTGCACCTCAACC
AGGTGAACACGTACATCATCTGCACCTGGCTCGGCTGGTTGTCCGTCGGCATCAACAGCTCTTTGCTGCCATATTTTGTG
AGTAGAGAGGAAGAAAGAAAAAAAGAGGAAAAGGAAAATCGAAACAAACCATACTAACTTCTCAGGTCTTCGGCTTCTTT
GCCCAGTTCTACCTTCGTCGCTACCACCCCATGCTCTTCACCAAGTGGAACATCATCATCTCGGCTGCCATCGGTAAGTC
TCCCTTTGCAACCACCTCCGAGACCAAGACTGACACTTCCAGCTGGTGGCTGCGCCATCATCATCTTCATCCTGACCTTC
GCCGTCGAAGGCGGCTCTGGAACGGCTCATAACTTCCCGGTAAGTCTCCGAAACATACTTTCTTCACTCCAACATCAAAC
TGACTTCGGCGTCTAGCAATGGTGGGGAAACAACATGGAAGGCAACGTCGACCATTGCAAGTACATGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62