GenePrediction:GLEAN_6668 Details

Name: GLEAN_6668
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:806242..804566 (- strand)
Length: 1677
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:806242..805584 (- strand)
Length: 659
Type: CDS
Source: GLEAN
Position: GCSC_156:805523..804566 (- strand)
Length: 958
>GLEAN_6668 class=GenePrediction position=GCSC_156:806242..804566 (- strand)
ATGACCATGGATCCCCGCGACGCTGGCAGCGATGACGACGAGGCCGGCACGGCGATTCTGGCCAAGGACGGACATGAGAG
CCGGCCGCTGCTGTCGGGGGAGTCGGAGCAGGCAGGATCGTTACCCTTCTTGTCCCCGCCATCGCCCGCTCGCCGCACTC
CCCCGCTGCGGGCCCTCCTGACGCTGATGCTGCTGACCAGCCTGGCCACGAGCCTGTACCAGCTGCCGGCCAGCCGGGTA
ATTGAGCGGCGGCTGTGTCTGGAGCACTACCAGACGCACGACCCGTCGCGCATCCGGCCGGACGGCAGCGTCGACGAGGC
CGCCTGCAAGATCGACAGCGTGCAGCGCGGCCTCGCCGGTCTGCAGGGCGTCATGGAGACGGCCTGGGTCGTGGGCGACT
TTGCCGTCACCGTGCCGCTGAGCTTTGCTGCCCAGCAGCGACAGGGACAACGGGGACGTCGCCGCGCCGTCCTCTGGCTC
AACCTCGTCCCCCGGCTCGCCCTGCCGGCCTGGGCTCTCGCCGTGCTGCTCTGCGCCCGCGCCCTGCCGACGCGCGCCGT
CGTCGCCGCCTCGTTCTTGTCCGTGCTCGGCGGCGACTGCGTGCTCGGGTCACTGGCCTACAGCCTCGCTGCTGGCCTGA
CTACCGATCCGGTAGAGAGGTGAGCACGGAGTACTCTGTATTGTGCTGACTCAGCTGACCCAGCTGACTCATCTCTCAGA
GCAACCTACTTTGGCTACATGGGCTCCATCGCATACGTCGTCGCCCTGATTGGTCCAGCGCTGTCGGCTGCCACGATGAG
CGTCGCCCTGTGGCTGCCGCTCGCCATGGCCGTCGGTCTGGTGCTGCTGTGCGTCCCGACGATTGCACGGCTGCCCGAAG
TGGAGGTCGACGTGGAGGTCGAGGACGTCCTGACCGGTCCAGCATCCAGCTCGTCCTCCTCTCCATCCCGGCCGCCCTCT
CACTTTCGCCGCCTTGCCGCCGTCGTTCGCAGCCACCCGCGCAACTTTGGCCTGCTGCTCGTCGGCTTCCTGCTCTCGTC
GCTGGCCAGCGCCGACACCCGCCTGCTGACCCAGTACATCTCCAAGCGCTATGCTTGGACCTTTGCCCAGGCCGGCTACC
TGCTCTCATGCAAGGCCGTCGTCAACTTTGTTCTGCTGGCCGTCGTCGTACCGCGGCTTCTGCGAGCACGGGCACGGGCA
CGGCGGACGGTCGCTCGCATCCCCGGGGACGCCTCCTCCCTCGACAACACCCGCGACAACCTCCTGCTGGCCCGTCTCTG
TCTCGGCGTCTCCGTCCTCGGCGCCGCCGCTATTGCGCTCTCCTCCTCGATCGCTATCCTCGTGCCCGCCCTGCTCGTCT
ACGCCCTCGGGTCTGTGCTGCCCGTCTTCACGCTGTCGCTGCTCAAGTCACCTGCTATCGTCCTGCCCGAAACAGTTGCT
ACGTCTGTCGCTGCATCGTCTACCACCTCGGCCGCCCCCACTGACCCCGAGACCCAGATCTTTGCTATTGTCATGCTAGC
CAAGACGCTCGGCTCGCTTATCGGTGCCCCGTTGATGGCCGCCCTCTGGGTCTGGGGTATCACCCTCGGCGGCCTAGCCC
TCGGCCTGCCCTATTTTGTCAGCGCTTGCTGCTACTCTGTCGCCATACTCGTGCTTTCTGGAATTGTTGTGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62