GenePrediction:GLEAN_666 Details

Name: GLEAN_666
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1293619..1294871 (+ strand)
Length: 1253
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1293619..1293752 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_97:1293823..1293926 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_97:1294016..1294116 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_97:1294212..1294871 (+ strand)
Length: 660
>GLEAN_666 class=GenePrediction position=GCSC_97:1293619..1294871 (+ strand)
ATGAGTCTTGAGGCGCAGAGGCAAAAGTGGGGCGCAGCCCGAAATCGCCAACTTCAACATCTCATGGCTGCCGATGTTGT
CCTCGTCGATACCACGAGTAACGACCTCTGCGAGCGCGGCTTTCTCCACGTCCCGTCTTCCGCTTATAAACTCCCGGTCA
CAAGCCTCACGCCTGTGCGACTGTGATTAGACCTGGAGAGCCAGTGTTTTCGTTATTGGCCCTTTGCCGCGCCACAACGT
CGTCTCTGTGGACGCGCCCGACGCCATGGCTTCTTCAGCCATTCCCATGACACAGCTGGGCGAGCGGTGTAAGTCACTGG
CCCCTCCCTCTCTTCCGACTCGTGCCTATGGTTTCTTTTTTCTGGGCGAGCTGCTGTTGCTGACCGTACTCTCTCAGCCT
TCAACCACAGCGCCGGAAACGACGCTGAGGCGGAATATGACCGTCTGCGTGACCTCGCCCGTCAGGAGGCTGCAAAGCGC
AACTCCTGCTTTGACAAGGTGAGTTTTTGCTGTGGCCTTGGTCGTGCCGTTGGTCGTTTCCGATTCGCAGCCCCCCCTCG
TCCGTGGCTGACCGCCTCTCTTCCACCCGACAGTCTCACCAGGCGTACGAGCGCGGCGATGGGGCCAGCGCCAAGACCCT
CTCGACCGAGGGCAAGCGCCATGCCGCCGCCATGGACGACTACAACCGGCAGGCGTCGGAGTACATCTTCCGGGAGAACA
ACGCGGTGAGCCGGGTGGCCGGCGACACCATTGACCTGCACGGGCAGTTTGTCGAAGAGGCCGAGCGGATCCTGGAGCAG
CGGATCCGCGCAGCCCAGTCGCAGGGCCAGACGCACCTGCACGTCATCGTTGGCCGCGGAAACCACAGCGCCAACCACGT
GCAGAAGATCAAGCCGGCGGTCGAGAAGCTGTGCGGCGAGCTGGGCCTGCAGTACGCCACCGAGGAGAACGAGGGCCGGG
TGTACGTCAACCTGCAGGGCGGTGCCGTCAGCGGCGTCCCGCCCCTGCCGCAGCAACCGTCGGGACATCTGGGCGGGTAC
GGCGGTGGTGGCGGCGGCGGCTACCAGCCGCAGTCCCAGCCCAACTATTCGGCCGCGGCTGGCCAGCAGCAACATCACGA
CCAGCACCAGCAACACCAGCAGCATCAGCAGAACCAGCAGCAGCAGGGAAACGACCAGCTCGAGCAGGAGATCGAGCAGG
CTGTCGGCAAGTGCCTGCCGAAGCTTCTGCGCGGCTGCTGCACGATTATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62