GenePrediction:GLEAN_6674 Details

Name: GLEAN_6674
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:786104..785011 (- strand)
Length: 1094
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:786104..785726 (- strand)
Length: 379
Type: CDS
Source: GLEAN
Position: GCSC_156:785639..785011 (- strand)
Length: 629
>GLEAN_6674 class=GenePrediction position=GCSC_156:786104..785011 (- strand)
ATGCATCCGACAGACGCAGCCGACGAGAACAACCGGTCTGCAGAGAGGCGGCCTGCTCTCGCTGATTCGACCTTCCCCTT
TGGTCGCCTCTCTGCCGGACCAGAAGACGGGTCGCCAGGGGCGACGTCCGCTGTTTCATCGCGAAACCGGTCGGACTCCT
GGCCCGTCATGCCACCTGGACGTGCGTCTGGGCGGGGAGGGGAGGACAAGAGACAGCTGCTGCGCGCATCCTGTCTGTCT
CGACGGCGATGGGACGACATCGTACGTCTGGTCATGCCAAAGCCTGCGGCTGAAACAGACATGAGTCTTCAGCGCTCGCT
CGCCCCTCGATCACGCTGGAGGCTCGTCGGCGCCTCGTCTGCCGCCTGTGCCTATATGTGTAGCTCGGAGACGTCTGCGT
CTGATCAGCCAGTGACAGACCGGCTGCTTACACCATACATTTTCCTGCATCGTCTCGTCCACCAGTGCTGACTTGTCTCA
CCATCGCTGCCGGCATGAGCTCTACCGGCCCACGTACCAACGGCAAGAGCCCGCCGTTCCGTGTCAACAGGATGCGGCCG
GCTCGCGACCAAAACCAGAACCAGAACCAGGCCAGCGGCTCCATCGACGCCCGCATGACCGGCTCGTCCAGCGTGAACAA
CAACTCGTACGCTTACACAAACGTCCTCCCGTCGTCTCCTCCTGGCCGCTCCAACGGCCGGGCTCAGAGCCCTACCAACA
GTGGCGATCGCTATGACTACTACCGTGACTATCGGCCGCAGAAACAGTCGCCAACGTCCGACTACGGAGACGACGGCAAT
GGGGGTGGCCGAAACGGCGGTAACAGAAGCAACGCTGGCTCTGGCAGCGACAGGGACAGAGACGGCAGAAACGCCAGCAA
CGACGGCAACACCCGCCCGTTTCAGCACCACGTCTCCTTCTCCTTCAACCTCGGCCCGACTGGTGATTACTATACCGATA
ACAGAAACGCCAACGGTGGCGGCCTTGCGGGAATGCCGGTGCAGATGCCGCTGTTTGGATCAGGGTTCCCCTTTGGTGGT
GGCGGTGGCGGACAGCGTGGATTTGGCAGCTTCTCTCCGTTCCGGCCGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62