GenePrediction:GLEAN_6675 Details

Name: GLEAN_6675
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:778789..777774 (- strand)
Length: 1016
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:778789..778543 (- strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_156:778387..777774 (- strand)
Length: 614
>GLEAN_6675 class=GenePrediction position=GCSC_156:778789..777774 (- strand)
ATGAAGGTCGCCTGGGAACGGCTTATCCGGTTCGTCGCCACCGACGGCCGCACGCTCTACGGTGAGCCCATCATGCCCAA
GGCCGACTTTGACCTGGGCGACACGACCGCCGAGACCGGCCTCACGGCCAAGGTCCTGGAGGGCAGCGACATCTACGACA
CCACCGGCAAGACGCGTGTGACTGACGAGGTCGTCACCGTGAAGAAGCTGTTGGGGCCGCTGACTCCGGCCGACGTGCCT
ACGTTGCGTTGTGTAGGGTTGAACTATGCGACACACAGTGAGTTTTTTTTTTTCTGTTTTTCTTTTTCTTTTTCTGTTTT
TCTTTGTTTTTTTTTGTTTTTTTCCTTCTTCTTTCTTTTTTTTCTTTCTTCTTCTTTCTTCTTTCCCCCCGCTGACCAAC
AGTTCGCGAGGCCGGCCGCAAGCAGCCTCCCTTCCCGTCCATCTTCTTCAAGCCACCTCCGACGGTCGCCGACCACGGCG
CCGATGTGGTCGTTCCGCGCATCGCCCAAGATGACCAGGCCGACTACGAGGGCGAGCTGGTCGTCGTGCTGGGCCGTGAC
GCCAAGGACGTCGCCGAAGCGGATGCCCTTGACTACATCGCTGCCTACACGGCCGGCAACGACATCTCGTCGCGCAAGTG
GCAGCGGGATCCCGCTCGTGCTGGCGGTGTTCCCCAATGGGGTTTCTCCAAGGGCTTCGACACGTATGCGCCTCTGGGGC
CAGTACTCGTGGCCAGCGGCCTCGTCGGCGACCCGTCCACGCTCCAGCTCAAGACCATCGTTGACGGCGAGCTCCGCCAG
AGCGCTGGCCTCGATGACCTCGTCTTCTCTGTTCCCCGCCTGATCGCTCACCTCTCGTCGGGCACCACCCTCCAGAAAGG
CAGCATCATCATGACCGGCACCCCCGGCGGCGTCGGCGCCGGTCTCACCCCGCCACGCTACCTCGTGCCCGGCACCAAGA
TGGCTATCAACATTTCCAAGATCGGTACCCTCCGGAACGGCGTCGTCTTTGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62