GenePrediction:GLEAN_6678 Details

Name: GLEAN_6678
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:768520..764095 (- strand)
Length: 4426
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:768520..768224 (- strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_156:768173..767982 (- strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_156:767810..767746 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_156:767688..767212 (- strand)
Length: 477
Type: CDS
Source: GLEAN
Position: GCSC_156:767152..766593 (- strand)
Length: 560
Type: CDS
Source: GLEAN
Position: GCSC_156:765991..765935 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_156:765875..765571 (- strand)
Length: 305
Type: CDS
Source: GLEAN
Position: GCSC_156:765519..765217 (- strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_156:765151..764930 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_156:764685..764095 (- strand)
Length: 591
>GLEAN_6678 class=GenePrediction position=GCSC_156:768520..764095 (- strand)
ATGGAGCCGACTGTTGAACATCACGCCGACGGTGGCCACCATATCTCGCACATTGTCGAGCACATCGCCATAGATGCCGG
CTCCAAGAGCCATCACGGCCTCGGACTGTGGCCGCCACCGTCCAGCGATCCGCGGGACCCGTTGCGGTGGCCACGCAGCG
GCAAGCTGCTGGCCCTCGTCGTCACCACCTTCTTCAATTTTGTCGGCAACTTTGCCAATGCCGGTCTCTCGGTCGCGACT
GTGCTGCTCGAGATGCAGTTCCACAAGTCCGGCCAGGAGATCAACAAGCTGCTGACTGTGCGTCTGCTCTACTTCTGGAT
GAACGAGTTCGCATGCTGACGGCCCAGTTCAACTTCCTCCTCCTCGGCATCGGCAACCTGGTCTGGGTGCCACTGTCGGT
CAAATTCGGCAAGCGTCCGATGCTGTTAATCTCCTCGACCATCATGTTTGCCACCCTTCTCTGGGCGGCCAAGGCCACGA
CATTCAACCAGCTGCTGGCCTCTCGATGCATCCTAGGCTTTGCATCTGCCGCTGGCGAGGTATGTCTTTGTGACACGGAA
AAAAAGAAAAAAAAGAAAAAAAAGAAAGAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAA
AGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAAAGAACCGATTTACTCACCATCTTCTCAGAGCATCCTCC
CCGGCATCGTGTCCGACATGTTCTTCCTGCACGAGCGAGGAGCGATGATGGCCATGTCAGTGACCAGCCGTGTAATGTGT
CGTGCCTCCAACACTGGCTAACCCCTTCGTAGCTATGTCATCTTCATCTCGTGCGGCTCGGCAGTCGGCCCCCTGATCGC
CGGCTTCGTCGTCCAGGACAGCCCGGGAACGTGGCGGGACTACGAATGGGTATCTGCCTCCCTGGCCGGCTTCACCCTCG
TCGCCATCTTCTTCTTTTATCCCGAATCCTCCTTCATTCGACCGTCAACCGACGAGGACACACCCTCTGGCTCTTTCGAC
CTCGCCAGCGACCCGGCCAAGAAGGAAGAGCTTGACGGCATGTCCAGCCGGGTCGAGAATGCCGTGCCAGCCGCTGCTGC
CGTCGCTGTCGGCACCGTCCCGGTCGTTCCCATCTCGTACCCGCGTGTCTGGACGTCCTTTTTCAAGATCAACCCCCTCG
TGCGGCTCCATCGCGCCTTTGCCATGCCGTTTGCCTTTGTCCTCTGCGTGCCCGTGCTCTGGACCATCTTTATCTACGGC
AGCTCTCTGGCGGCGCAGGTCATCATGATGTAAGCAACGTCCCGGCAGCTCTTCCGGCTCTTACTGTCTGGTCGCTAACA
TCGACTAGCTTCTCCTTCCCGTCGCTGCTCCTGGCCCCACCGTATCTCTTTGCCGCCAGCAGCGTCGGGCTCATGCAGAT
CGCGGCCCTCATCGGCTTCGTCTTTGCCTGCTACGGCGGCGGCTACATCTCGGACGTGATCACGGCTCGGCTCATCATCC
GCAACCGCGGCACCTTTGTGCCCGAGCAGCGCCTCGTCTCCATCCTGCCCGGCTGCTTCATCGGCCCGGCCGGCTGCATC
CTGATCGCGTTCGCCTGCGACCGGTCGCTGCACTGGTCCGCCATCGCCGTCGGCTTCGGCATGGTCTCGTTTGGGACCGT
CTACGCGCCCAACATCGCCATGACCTATCTGCTTGACTGCTATCCCGAGTTCTCCCAGGAGATCCTCGTGGCCGTCAACG
TGGTCAAGAACCTGGTCGCCTTCCTGTTTCTGTACGTGGCCGTCGACTGGATCAAGTCCCAGGGCTGGATCCAGGTGTAC
ATGATCATGTTCATGGTCGTCACCCTACCCCTTCTCCTCGCCATCCCGCTCTACTATTTCGGGCGCAGGGCGCGGGAGGC
GTTTGACCGTGTGATTGTGCGGGTCCCTGGACCGCTGGAATACTTTTTCTAGTTGTCTGTCTCGTGTGGCTTGGTCTTGT
ACAGTTCGAGCTAGACAAGTTGAGGAGCATGGGCTGACATGAAGACCTGATTGTGATAACAGTGGGCCGCATGCATCATC
TGCAGCATAACTCTGTCAGCTCGTGCAGATCACATTGCATTGTAAGCACCACAAACGATGTATCTACACGTCCACGTAGG
ATGCAACGGACTTGTCACCTCCGTGTCCAAAGACGTATTTCGCCACCTTCACCGGCCTCCACCTGTCGGTGTCACTATTT
TATGGGGGGAGGCAAATTTGCCCAGATTATGACCACCCTAACCGCCACTCCTTTCTTCATCTCACTCCACAGAGATCTGC
CCTGCCACTATCACCAAGCCTGCTCCGTGCGGACAGGGGCGCCTACCCCTCACGCCTTCTTCGCATGACCACAAGTGGAC
AAAAACTAGGACCGAGAGCGTCCATTAGTGCACAGCCCCAGACTCCCTGCAATGCCGTACTGCCGGTCTGTAGACAGCCC
TCAGCCTGTGCGGGAGGCTCCCCGAAGATGCCCCGCTCTCAGCCGCTAGCCAACCATGGGGCTATAAGTTCGTCCAGTCC
CCGCGCCCAGTCGTTTGTCTGGTTCGGTGAGCGCTGTACAGCCGAATTAAAAATAAGACCCACGCGAACGAAACCATGCT
TGCAGTAACGGCACTCCCCACGGGCGCGCGGCCGACCTCGTCCAAGGTCGAGTTCGTCGAGTATGTCGAGCAGATCGAGA
CGGCCGAGCAGGACGACGTCGTCGAGCACGCCATCCCTCTCGTCCTCCACGGCGAGACGGTGCTGAACGAGCTCGACAGC
AGCCGGCGCCACCTCCTGCCGGGTGGCTACTTCCAGGGCGCCGATGTCGACGACTGCCAGCGCGCCATCGAGAGCAGCGC
GGCCGCCTTCGAGACGTGGTCCCATGAGTCGCCCATCGCTCGACGACAGCTCCTTATGAAGCTCGCTGCTGTACGTGGAT
GTAGGCGTCCATGTGGCCGATCATCACTGACAGATGCTTAGCTGCTCCGCGAACGCGGAGACGAGGCCAAGGCGCTCACC
CAAGCCGAGATCCACTGCTCCGAGCTCTGGGCCGATATCAACCTCCAGGGCAGCATCGGCCTCATCGAGGAGACTGCCGC
CATGCTCACATCCACCGCCGTCCGAGGGTCCATGCCGCACACCGCAGCACCCGGGTCCTACGGTATGGTCTTCACCCGTC
CCCTGGGCATCGTCGTCGGCATTGCGCCCTGGAACGCGCCGCTGCTCCTGGGCTTCCGTGCCGTCGTCGCCCCGGTTGCT
GCTGGCAACACCGCCATTCTCAAGGTAAGCAAGCAGGCAAGCCAACCCTAACCGCGTCTCTTTGTGATGACTAATCATGT
TATCTGCAGGGTTCCGAGCTCAGTCCGAGAACACACTACTTCATCGCCAACCTGTTTGTTGAGGCGGGCTTCCCGGCCGG
CGTGGTCAACTTCGTGCTGCACCGGCCAGAAGATGCGTCTGACGTGGTCGACGTTTTGATCAAGCACCCGGCTGTGCGCA
AGATCAACTTCACCGGCTCGACTGCTGTCGGCCGGATCGTCGCCCAGAAGGCCGGACAGGCCTTGAAGCCGGTGCTGTTG
GAGCTGGGCGGCAAGAACGCGGCCATTGTTCTGGAGGACGCCGATCTGCCGAGGGCTGCAGAGGCCGTCCTCATGGGGGC
CTCTTTGAATGTGGGTTTTTTTTTTCTTTTTTTTCTCCTTTCTTTTTCTAATACTCTTTCCCCCCACTCCCCTTTTTTCC
TTTTCTCCTTTCTCCTTCCCCTGGTCCTTCCCCCTTCTCCTCCCCCCATCCTCCCCTCCCCGCTGACCGTCACAGAACGG
CCAGATCTGCATGTCGACCGACCTCGTCGTCGTCGTCCGCGCGGTCGCCGACGCCTTCAAGGCCGAGCTGCAGAAGGCAC
TCCGGCAGATTGACGGGACCAGCTGGACGGTCATCTCGCCACGCAGCGCGGCCAAGCTCGAGGGCCTGGTGGCTGACGCG
GTCAGCAAGGGCGCGACGGTGCTGTCGACGGCGACAGCGGGCAGCCGGAGCGGACTGCCGCCGCCACCACAGGACCTCCC
CTTCCGTCTGGTCGAGGACCTCACGCCGGCGATGCACTACTTTGCCGAGGAGTCGTTTGGGCCGATGCTCGGACTCGTCG
TGGTCGAGGATGAGGCCGCGGCCGAGCGCGTCGTCAACGCGTCCGAGTATGGTCTCTCGGCCGCCGTCTGGTCGCGCAAC
CACCACCGGGCCCTCGAGCTCGCCCGCCGCCTCGACGTTGGCGCTGTCCACATCAACGCGCCTACTGTCCACGACGAGGC
TACCCTGCCGCACGGCGGCAGCAAGTCTAGCGGCTTTGGCCGCTTCGGCGCCGAGTGGGGCCTCCTCGAGTTCTCCCAGT
CCCAGACCGTCATCCTGCACGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62