GenePrediction:GLEAN_6679 Details

Name: GLEAN_6679
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:752087..750792 (- strand)
Length: 1296
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:752087..751551 (- strand)
Length: 537
Type: CDS
Source: GLEAN
Position: GCSC_156:751498..751370 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_156:751303..751200 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_156:751137..750792 (- strand)
Length: 346
>GLEAN_6679 class=GenePrediction position=GCSC_156:752087..750792 (- strand)
ATGTCCACGGATTTCAGCTATCTCCTGGGGCCAACCAACAGTGAGGCTATGCGTGGTACCACAGAGGATGGAGCCCTACT
TCCTGGAGATTCGCAAAGTCCTGGCTCCCTCCTTTCTCATACCCAGTCTCGCTCTATCGACTCTCACTATGACAACCTGG
GAGGCAACAGTCTCGCCATGCCATCCATGCATCCCAACTCGCTCTATAGTCCCTCGAAGACACAGACCCGCCTTCCACTG
TCCCTTCCGCTGCAACAGTTTCCCGACTGCCTGACTCGCCTCCCGAGTACAGATCCAGTTCACAGGTATGGCACGCGGCT
CATGGTCCAAGTGCTGCGATCCTATCCGGCCATGATGTTGCGAAGGGAGACGTTTCCACCATTCATTCACGCGCGGAACG
GCCGCGGCACCCAAACTCTGCCGGCACCGCTGGCCAACTGCATGGGAATCGCACAATTGTTCGCTGGACGTTCACCAGAG
ACGCGTTCTTTTTTGTGGCACTCGATCCGATGTGAGAGTCAGCATGCCATGAACAACGTAAGCGACTTCTTGATGGGGAT
GTAGGCTTTCCAGCTGACTCTTTGTTCAGGCTTACTCTATGTCGAAGGAGGACCTCCTAGCATCCGTTCAGGTGCAGATG
ATCTTCTTGATCATGCGCGTCGTGGATGAGGCCATTGATCCTCCAGAGCTCAACTATGAATTGCTGTGGATCTTTAAGGT
GGGCAGTCTTGTCTTCACAGACTGGGTTCCTATGGCCGCCAGCGTATGCTAAACTCACACGCAGCTTCTCTGCACACGTT
TTGCAGAGGTCGGGATGCCTGATGGAGAGGCCACCATTGCAGCCAACACAGAATGGGAAGAATGGGTGCAAACAGAATCC
AAGATACGGTGTGTTGAGAAAGATTACTTTCCAACTAGTGACAGTGTTTGCTAATACGAAAGCCTCCAAGGACCGCGCTC
ACCTTCTTTGTGATTAGTCAGATTGTTTCTGTGTATACAGGAATCAAGTGTGGACACATGGACGAGTTCCAGAGCATTCC
ACTCTGCTCGGCTAAGACACTGTGGGAGGCACGAACCGACGTCGATTGGGCATCGGAACGTGCCCTGACACTGCAGCGGG
GTGATGGCCTCCAGACCATTGGCGATTTGATGCAGTTACAGAGCATGTGTGGAGGCTCGCAGCAGGAAAGAGCCTTGGAC
AGCTGGAACGCATCTGCAGACGGGTTGGGCCATTTGCTTGGCATAGCGGCGAGCATGGTGAGTTGTGCTGAGAAGAAGTC
CATCGGCACTTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62