GenePrediction:GLEAN_667 Details

Name: GLEAN_667
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1296195..1300396 (+ strand)
Length: 4202
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1296195..1296277 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_97:1296313..1300396 (+ strand)
Length: 4084
>GLEAN_667 class=GenePrediction position=GCSC_97:1296195..1300396 (+ strand)
ATGGCTGCGGCCGCGCTCTTGAAGACAGCCCGGTCTCTGGATCAGAGCGGCCCCGAGACGACAGCGGCCAAGCTCGAGCG
GTTGTGGGCTGCCCTGGCAGCGTCACTACTGCCGACAGTCACTGTGACTTCTACGCGTCTGAGGAGGTGGCGCTGCGGTG
GATGCTCAAGAACACGAGCGGCTCGTCGGCCGAGGCCGAGACGCTTCGCCGGTGGCCATTGACGTGGCACATCTTAGGCT
GTCTCTTTAGGCGCATTCCGCTCTTCACGCTGGCCAAGACGCTGGCCGACCGACGCTTTGTGGCGGTGCTGCAGCAGACG
GCGTTGGAACTGGGCGGGAGGCCGAAGGCGAGCGAGAGCGAGAGTGAGAGTGAGAGCGAGAATCCCCGGAAGAGAAAGAA
GTGGCAGGCAGTCAGATTCGACCTGGAGGCGCTGCAGAAACCACGGCAGCGGGTGTTGTCGGCAGGGGCACTCTTTGGGG
CGCTGCGCGTTCTATTAGGGCGTCTGGACGAGGTCAAGACGGCGTCTTGGAGCCAGGGGAGCCTGTACGCTTCGCACGAC
CGGATCGGGGCCGAGCAGATCAAGTCGTTCTTCTGCACATCGGGCACCGATGCGATGACGCTGCTGGTGCCTCTGCTGCA
GGTGTGCCGACTGGCTCTGACGACGAGGGACGACGGTGACAAAGAGAACAAAGACGACGACGACCAGGCGGGCTGGATCA
CGACCTTTTCGGCTCTCTGGGACCTCCGGCTGCAGAGCCCGACCGACGCGCCAGCAGTAGCCCTGAACATGACGCTGGAA
GGCTGCAGCATGCTGCGTGAGCTGCTCGCTGTGCCTGGCGCAAAGGGGCGGCAGTGCTGGGCGGCGGGCCTGCAGCGGTT
CCTGACCAACAACATGGTGCTACCGGCGCGTTCGGCCTATCTGAACCACAAGGACCTGCACACACTGGAGCTTGCGTGCG
ACAAGCTCAAGGGCCACGAGGTCTTGTTGCCGGTGCTGTTCCTGCTGGCGGTCCAGGCGCCACGCATGGTTGGTGGTGGT
GGTGGTGGTGGTGCGGCAGCGGCGACGAGCCGAGACAACGAGCGGTGGCTGCAGGTGGTCTTTGACGCGATGCAGCAGCC
GCTACTGCCAGCCGTGCAGGGGCGCAACTCAATCCTGGCCAGGCTGCTGGACCTGGCGGCACAGCACGAGGCCTCGCCGG
CCCGCGAGAGCCTACAGGCAGTGTGTCGGCGGGCGGCTATGGCTTCGAGCAAGGACGAGGGTCGAGGGACGACAGACTGG
GGTCTGGTGGCGTCGGTGGCTCGCTGTGATGCCGACGCGTTTCTGGTGGCGCCGGCTGGCGATCAGCTGCTGGACGACCT
GCTGCAGGACCTGGCGACGTGTCGGCCGACGCTGGCGGCTGACCGGCAGTCCGTGTCCATCTTTCTGGTCGCACTCGCAC
GGGGATCGGCCAAGGCCCACAGCCTGCCGGCTTTTATCGGGCGTTGGTGTACAGGTCTCAGCCAGAGCGGCGACGACAAC
GTCTGGCTGGATCGAGCCATCCGTACGGCCGTGGCCGACGTGCTGCAGACGGCGCTGACGAAGACGCAGCTGCTGGAGCT
GCTAGACCAGCTGGACGGAGCCTCGGCCGTGTGCAGGCTGGTGGTTCTGGACGCCGTCGGTGCGGGCATCCGGCTCGAAG
AGTACGAGGACGCCGTGGGCAGCCGGATGGCCGAAGCCGTGGTTGGCGCGGACGTGTCTCTAGTGGTGTCTAGTTCGATT
CGGGCGATTCGCTGGCGTCTGATCCGGCGGTCGCTCGGCTGGCTGGACCCGGCTGCGGCCATGAGCCTCTGGATGGCCGT
GCAGAAGCAGCTGGCCAAAGAAGAAACGGCGATGCTGGGCGAGCTCACGTTTGAGGCGCTCGTCTGCGCGTTTGCCTTTT
GGATGGCGCTGAAGAACAGCAGCGGCACGGCCGAGCAGGACGCTCGCAACCTCACCTGGGCGCTTTTTGGTCAGTTTCAG
GGCGCACTGGCTGGTTTGGTGGACGAGGCCGATCAAACGGCGGTCCGGCTGGAGCTGACACAGCGCGTGGCTGCGCACGA
CGACAGCAGCTGCTTCGACTTTGACTCCCGAGCGGCCACGCTGGCGACGTACCTGGCCTGGATGCTGTGTGGCTCGTCGC
GTTTTGTCGAGTATGTATTCCCGTTTCTGGCTCTGTTTCCGGCTATGACTGACTCTTCGGTGTTGTGTTATAGCGAGATG
ACGAGGAGCAGCAAGGAGCGGTCGGTGGTGGTGTTGGACCTGTTGTTGCCGTGGCAGTCTGGGGCTGTCCTGACGCTGGA
CGACAAGGCTGCCGGCATGATGACGGAGCGGTACATCCGGCAGCTGGAAGAGGCCAGTCGTCCCGGCGGACAGCAGTGGC
TTGAGGCGACCGGCGGGCTCTTGCGCACGCCGGCAAGTCTGCTGCCCCGTCGCCTGCGCGAGCGCGTGATGTCGGCGCTG
CTGCCGGGCGAGAAGCCAGTCAGGGACCAACTGCATATGTCGGTCGAGGACGCCGTGGTGGTGCTGGATTTACTGATCCG
CGTGACCCGAGAGCGAATGGCCGGCGACATGGACCTCGACCGACTCGTATGGCTCGGGATGGTGGTCGAGGCCACGGCCG
CGTCTGTGGCCCTGCCGTCTGCTCTCGGGCTCATGGACCGGTACCGCTGCATCGTGGTGGCGGTGCTCCAGCACAGCTTG
GGCGAGGCCATGTTCGAGCGGGTCTCGTTTTGGGTGGCTGCTGACAAAGCATCGGCTGTGCTGCGACTCATCTTGTTGCA
GGCCGTCCTGCTGGCCACAGCGAACACACCGGCGGCCAGCAAGCTTGGCGTGGCACCGGTAGAACGGGCCCGGGAGGCGC
TGGCCGGACTTGTCGTTGCCGTGCTGCGACAGGCGCTGGAGAACAGCAGCAGCAGCACGGTGCAGCTTCTGCTTGCTTTT
GACGCCATCTTGGCCGACGACCTGCCGGACATGCAGCCGCAGCTGGAGCAGCAGGGCTTGGCATCGCTGGCTGGCCCGAT
GCAGACGATGGCCAGGCGGCTGTGCAGCCAGAACGACAAGGTTGGCTGGAAGTGGAGGGCACTGATGGCACGGTATTTGT
GCAACGATGACAAATCTCGGCGCGAGCTGCGCTTTCCGGGGCTCTTTGTGGACGAGCGACCGGAAGAGGACGACGGAGAG
ACGATCGCCTGGACGGCCGCCTCGGTGCTCGTGGACAGCGACCTGCTACAAACCTACCTCGTCAACGAGACGCGCAGCTA
CAGCCAAGAGTCGCTGTTGTCGTACATCCAGGAGCTCGTGGAGGATGACAAAGACAAAAATAAAACATCCACATCGACCG
TCGGCCAGCTTCTGGCCATCCAGCACCTGCTCGGCCGGCTGCTGGCCCAGCCTGGAGCTGCTTCCATCAGGACCGATGAT
GGCCGCTTCGACCTGGCCGTCGTGCACAGCCGCCTGGCCGAAAGGCTGCCGCGAGCTGCTTCGGTGACGGAGGCCCGGCT
GCTGGGCCAGACGCTGCGCGCGCTCCTGCTGGACGACCGTGCCGGCGCTGCCGCCATGGGGCAGTGGAACGTTGACGGCA
CGCTGAGTGCTGTGGCCCTGGCCGTCGCTCTAGACGGCCGCAGCGACGACAGCGTGCGATCTTCTGCCGGCATGTTTGCT
GTCGCCTGTCGTCTCGTCGAGGCTGTCCTGAAACGCCACCGACTCCGGCTCGAGGGCCGCTTCCACCTCGTCGTCGCCAC
GCTGCAGGCCCTGCTCACCCGGCTGCTCCAAAATGGCGGATGTGTCTTTTGGACCCCTCAGGCCACCCAATTCGCCCGCC
TGCTCGAACTCGTCTGCGAGCCCTCGACCGCTGCCGTCGCCACCATGACTCGGCGCGGTCCCGCCGGTGCCTCTCTCACC
GCTGCCGCACCCGTGCTCCATTCGGCCACCGAGGCCGCCCGCCGCTCTGCCGGCCAGCACATGTACCTCGTTCTCATGGC
CTACGTCAAGCTGCAGATCGACGGCGCTGTCGTCGTTCGCGACCTGCGCGACGCCCTCGAGCCCGGCCTCTTCTCTGTCC
TCGGCGTCACCTCTGACGAGACCCGCCGCCTGCTCAACGATGCCGTCGATCCTGCCGGTCGCGCCCTCTTCCGCGACCTC
TACCGGCGCTGGCTGCAGTTTGGCAAGTGGAAGGGCGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62