GenePrediction:GLEAN_6680 Details

Name: GLEAN_6680
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:746380..743999 (- strand)
Length: 2382
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:746380..746258 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_156:746196..746111 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_156:746059..745795 (- strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_156:745741..745618 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_156:745552..745154 (- strand)
Length: 399
Type: CDS
Source: GLEAN
Position: GCSC_156:745091..744981 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_156:744918..744823 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_156:744755..744646 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_156:744589..743999 (- strand)
Length: 591
>GLEAN_6680 class=GenePrediction position=GCSC_156:746380..743999 (- strand)
ATGTCCAGGTTCACGCTCACAGCTCTGCTGGCCCTCGCGGCCGGCAGTGTCAACGCGGCATCGTCGCTGGCAGACATCAA
GCATGTCATCATGATCATGATGGAGAATCGCTCGCTGCAGCATGTGAGTGCCGCCATTCGTCTTGGCTACAGCGGCCATG
GTGCCTGCTGACCCTAAAAAACAGTACTTTGGTACGATGGCCGGTGTTCGTGGCTTTGCCGATCCCAACGTCCAGGTGAG
CCCGAACACGAACAAGTCGGTCTGGTACCAGTACGTGGCCCAAAAACGCCTTTCTTTCTCTTCTCCTTGCTAACGGTCAA
GGCCGGTGGACAACCTGACGACAGAAGCGGACTATCTCCTGCCGTACTGGCTTAACTACGAGAACACCGAGGAGAGCTAC
AACAAGAGCCAGTGCCTCTGCTCCGGTGCCAACAACTGGATCCCCACGCATCATGCGATGAACTCGGGTGCCAACGACCA
GTGGGCTGTCATCGACGACCCGCAGTCCTGGGGCTACTTTAAGCGCCAGGACATTGCTTACCACTTTTCCCTGGCCGAGT
CCTACACTCTGGCCGACATGTATCATGTGAGGCTACCAAAAAGAGCATCGTCCCGAGGATGGCTGACTAATACACACAGG
CGGCCGTCATGACCAACACGGACCCCAACCGTTGGTACTGGCAGTCCGGCACGATCAACGTTCCCGGTGGCAAGACGCCG
CTCGGCTCGGGAGGTGTGATTCTTGACGACAATCAGAGCAACGGTAAGCGGAAGAGGAATTCTAAGGAGCTAGTTTCCAT
TCGGTGGATAGCAGCTGATATATTCTAGGTTGCGTGGACACCGACCTCGACTGCCTTCCTCTGCAGTGGCCTGCCTTTGC
CCAGTACCTCGACGAGGCCGGCGTCGACTGGCGATCGTACCAGCAGTCGTACAACTGGGCCACGAACAACGGTCTATTTT
ACTTTGAGGCCTTCCAGAAGGCGGAGAAGAACTCGAGCCTCTACCAGCGCGGCCTCGCCTTTGACGGAGACAACAGCCTG
GACGCGTTCAAGAAGGCTGCCGCGAACGGAACTCTGCCCGAGGTCAGCTGGTGCTTTCCCCCCGGCAATCTGCAGGAGCA
CCCGCCCTTCACGCCGCAGGATGGAGCCTGGTGGATCAACGAGATCGTCAACGCCTCGATCCACGGCGCCAACTACAACG
AGACCGTCATTCTGCTGAACTGGGACGGTGAGCAGAATGTCCAGTCCTCCCGTTGCGTGATAAGTGATAAGCTTCTGACG
ACTGTGCAGAGGCTGGTGGCTGGGGCGATGCCGTCATGCCGGTGATCCCACCCAACGGCACTGCTGGCGAGTGGTTCGAG
GACCCCTACGGAGAGCTCGGGTACACCTGGTCTGGTCCTGGTATGTCCCGTCCGGCTCCCAGTCCAGCAGACGTTGAATC
ATGCTGACATGACATCCACCAGGTGTTCGCGTCCCCCTGATCATGATCTCGCCTTATACTCGCGGTGGTCACGTGTTCAC
CGAGCGTGGCGACCACGCTTCGATTCTTCTCTTCCTCGGTAAGGCCATGACCCGTCTTTCTCTTGACAATAATGACAATG
ACATTGACTTCTGACCCGTGTGCAGAGAAGTACCTTGCTGCTCGTGGCTACGACAACATTACGGCCGAGGCCCAGATGTC
CGACTGGCGCCGTGAGCACGAGTCCGACCTCGTAAACGCTTTTGATTTCAAAAACGTGAGTTCCGCATCTTGCTCCGGCG
AGTACAACGCTGTTTCTGACATGCAAAACAGCCCGACTTCAGCATCCCGAAACTCCCGATTCCCCAGACGCCCATCCAGG
ACTCCTCCGGCAACCACATCGGCCTGTACAAGGGCTACTGCAGCGCGCATTTCGGCACGTCCTGTTCCGGCAGCAAGTAC
TACGCCCCGTATCCGTACGGCAACCAGACCGAAGAAGAGGCGCTCTACTTTGAGGACGGCTACAAGGGTGTTCGCGGCTA
CCTGACCGAGGGCCGCTACCTCGTCTTTGAATCGAACGGCTACGCTCTCTCAACCAACGGCAGCAGCAAGGCGCTCACCG
CCACAAAAGCCTCGGCCAAGCACGAGGATATCCAACAGCGCTGGGTCCTGCACGCTCTGGAGACCGAGGGCACCAGCTTT
TACATCACCAGCGCAGCCAATGGCTACTACATCTCGCAGCAAAGCGCTCTCTCGAAGCTCGAGAGCGCCGCGGAGACGTA
CAACATCACGTACATGGGCAACAGCTTGTACCGGCTGCAGGAGGAGAGCGGAAAGTATCTCAACATCAACGCCAATGGCA
AGCTGTCGTTTGACTCTACGCCCACCGGCTACAACGCGTACAGTGTCACCTACCATAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62