GenePrediction:GLEAN_6682 Details

Name: GLEAN_6682
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:732999..731000 (- strand)
Length: 2000
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:732999..732771 (- strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_156:732629..732202 (- strand)
Length: 428
Type: CDS
Source: GLEAN
Position: GCSC_156:732143..731841 (- strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_156:731770..731736 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_156:731674..731255 (- strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_156:731174..731000 (- strand)
Length: 175
>GLEAN_6682 class=GenePrediction position=GCSC_156:732999..731000 (- strand)
ATGGCCAAGGAAGCCGTCCTCTCTTCAGCCACCAGCGTCGACGTGGGCGACGAAGCCCCTCACGACACAGTGCACGCCCG
CATTGAGGGCTCGCCTCTGCCGTGGTACATGCAGACAAAGCTGCGCGAGCTCTACCTCAAGATGATCATTTTGTTTTTGG
GGTCGACCACGCTAGGCTACGATTCGAGCCTGTTGAACGGGTTGCAAACGATGGACTCCTGGCAGGAATGTGAGTCTAAA
GGAGAGGGGAGAGGAGGGGGGCAAAGAGAGAAGAGAAAAACCGAGCGAAGCGAGGAGAAAAAAAAGAAAGGAGAGAAGAA
AGAGAAGAAAAAGCCGAGCGAAGCGAGGAGACAAATGCTAACCAAAACAGTCTTCCATCATCCTAGGAGCAGCCGCTTAG
GCATTTTCGGCGCCATCCCCGGCTTCGGTGGCCTCTTCATCCTATTCTTCGCCCCCTACGTTGCCGACATCCTGGGCCGT
CGGTCAGCCATTGCGGTCGGCTGTCTGTTCGTCATCCTCGGCGGTTTGCTACAAACGTTTCCACCGGCCCACAACCCCAA
CGCCATGTACCTGACCGGCCGCTTCATCATCGGCATGGGCGCCAACTTAAACAACGGCGCCTGCCCGCTGCTGATCACCG
AGGTGGCCCACCCGCGGCACCGTGGCCGGGTGACAACAATCTACAACACGCTGTGGTACCTCGGTGCCATCCTTGCCGCG
TGGATCAGCTTTGGCACGCTCCGGAACCTTTCGGGCAATAAGGAGTGGCGGCTGCCGACGGGACTACAGTGTCTCATGGT
GTGTTCCCCATCAGGGCTCGGGGCTTCCTGGTGGTTCTCCTTTCTAACACGCACAGCCTGGCATCCAGCTGCTGCTTCTC
TGGCTGCTGCCCGAGTCTCCACGCTGGCTCATCAGCAAGGGCAGGTACGACGAGGCCAGAGCACTACTGGTCAAGTACCA
CGGCAACGGCATCGAAGACGCGTTTGTGCAGTGGGAGTTTGCCGAGATCAAGAGCACGCTGCAAGCGGAGCAGGAGGTCG
CTTCGCGCAACGGCTGGTTCGAGCTCGTCCGCACCCGGGGAAACCGCAAGCGGTGTCTGCTGATCATCGCCACGGCCATC
TTTTCACAGTGCAGCGGAAATGGACTGGTGTCGTACTATGTGGGCTTTCCTCTCCTTCAATTGCACAGTCGCCGTCCGCG
TTCACGTACTGATCCTCGTCTCTTTGCAGCTCTCGTCGGTCCTGAAAACAATTGGCTTCACAGAGTGCGTATCTGCCACG
CTCAAGACCTTTGACCATGCCCCAACCAGACTGACCCTGCTGCAGCTCTATAACCCAGTCGGAGATCAACGGCGGCCTCA
CCATCTGGTGCTTCATCGTGTCGCTGGGAGCGGCCTTTATTGTCGACCGCGTTGGCCGCCGGGTGCTTTTTTTGTTTTCC
GGCGTTGGCATGCTGATCACTTTCAGCATCTGGACCGCCTGCAGCGCCATCTACGCCAAGACGGGATCGGCCGCAACCGG
CAGTGCCGTGCTGGCCATGATCTTCCTCTTCTACGGTGTGGCCGGTGCTGCCTGGCCGGGCCTGACCGTCTCCTACACGG
TCGAAATTCTGCCCTACAACATCCGGGCCAAGGGACTGATGCTGTGCTTCTGCTTTACGTGTCTGAGCGGCATCTTCAAC
CTATACGTCAACCCAGTCGGGTTGGATACCCTGGCGTGGAAGTGGTACTTTTTCTACATTGCCGTGTAAGCAGGCGCCGA
GATCGACACAGCCGAAGATGAATGCCTGTACTATGTACCTTGCTGACAACAGATTTCGGGAACAGCCTGGTGGTGGAGTG
CCTTATCATCTTCTTCTTCTTCGTCGAGACCAAGGGCCCCACGCTCGAAGAGATTGCCGTGCTGTTCGACGGCAAGGACT
CGGCCACTGCGGCTGCACTGGTGGAGTCGCATCAGCAGGTGAGCAGGACCGGGGCCACCAAGCAGGAGGGCCATGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62