GenePrediction:GLEAN_6683 Details

Name: GLEAN_6683
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:730180..728735 (- strand)
Length: 1446
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:730180..730127 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_156:730036..730002 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_156:729954..729866 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_156:729808..729786 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_156:729727..729601 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_156:729553..729516 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_156:729459..729284 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_156:729235..728816 (- strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_156:728765..728735 (- strand)
Length: 31
>GLEAN_6683 class=GenePrediction position=GCSC_156:730180..728735 (- strand)
ATGACATACAGGAAAGAAGCGCCGGCTGACGACACGATCGAGGCTGGGGAAGTGGTATGACCCCGACCGGGGCCTCCTTG
CGTCTTCGTGGACTACCATGTGTCGATGTGCTTGCTGACTTGCATTGTCTGCTCCGTTTGACAGCTGGTCAGCGATGAGT
TCAACGCTGACGACTCTACGTACGTGCCTGCTGGCCCTGCCATTCCACCTTTGCTAACCGGCACAGGGCGTCCTACTCGA
CGTCGATCGCGTCCAGCGCAGCCGACTATCCAATGGAGTTTGGCCGTCGCTACCACGCATTCCGCCAAGGAAGCAGTAAG
TGCAGTCGTCGCTGTGGTGTCGAGACCGGCAGGCTGACCGTGACCAACACAGAATACATCCGGCCGAACGACCAGGTAAG
CGTGGAGGATGGCAGGCGAGCGATTCCGTAGCACACTTCTGACTGTCGCACAGATGGAGATGGACCGGCTCCTGATTATG
CACACAGTGGTCACAATGGCCATCGGAGGGCTGTACCGGGCGCCGATCGATACGTCCAAGGCGCAACGGATCCTGGACGT
GGGCACGGGCAGCGGTGTCTGTAAGGAGGGCCCGATCTCGTTGACAGGCGCTTGTTGACGGAAACAGGGGCGATCGATAT
GGCGGATGCATTGCCCGACGCAACGGTAAGATGGGGAGGGAGAGACCAAAAAAAAGGATTAAAAAAGATCTAACAGCACA
GATCCTGGGCACTGATCTCAGCGCGAATATGCCGGCTTTCATACCACCCAACGTGCGGTTCGAGGTCGACGACGTCGAAA
GCGACTGGGCCTATTCAACTCCATTCACCTACATCTTCAGCCGGTATCTGGCGTCGAGCATCGGCAACTGGCCACGGCTG
GTGGGCCAGGTCTACGAGTGAGCGGACAGAACGATTGAGGCCTGTGCAAGGCTAACAGGCCGCAGCAACCTTGAGCCGGG
CGGTTGGGCCGAGTTCCAGGACTTTGACCTCACATACTTTTCCGAGGACGGCTCGCTGCGGGAGGACGACCCGATGATGG
TCTGGGTCAGCCAATTGGGAGTGGCGGCAAACAAGCTGGGCCGCGAGCCGTGTCCGGGCCACCGGCTGAACAGCTGGGTG
CGCGCGGCCGGATTTGTCAACGTGGTGCACGAGCGCTACAAGCTGCCGATCGGACCGTGGCCACAGGACGCGCGGCTTAA
GCAGGTCGGCCTGCACAACTACATGCAGCTCAACCAGGGACTCGAGGGCCTGTCGTTGCGGCTGTCGACGGGCGTGCTTG
GTATGACCGTCGACGAGGTCCGGCAGATGGCCGCCAGCGTGCGCCAGACGCTGCACAACCCCAACGTCCACCCGATCCTG
CCATTGTGAGTAGGGCGCGCTGCCGAGCTGCTTTTCTGAATACTAACACCCGCAGCCACGTCGTCTACGGACAGAAGCCG
GAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62