GenePrediction:GLEAN_6684 Details

Name: GLEAN_6684
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:728064..726066 (- strand)
Length: 1999
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:728064..727145 (- strand)
Length: 920
Type: CDS
Source: GLEAN
Position: GCSC_156:727099..727000 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_156:726949..726841 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_156:726775..726628 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_156:726537..726066 (- strand)
Length: 472
>GLEAN_6684 class=GenePrediction position=GCSC_156:728064..726066 (- strand)
ATGCTCTCTCCACAACAACATCACTTCTACCGCCTCTCGGCGGCCCTATCTATCCTCACCATCCACGTCGCTTTGGGCTC
CTGCATCGGCCTCCGCCCCCCTGGCATGCTGGTCGATATCCATCGTCGTGACGGTGTGTTTTTCGCCGGCATGCCTGCGT
CTAGTCCTAGCGCCAACATCGACATCAACATCGCCAGCACCAACTCTACCTCCACCACTCTAGCTGGCACCTCAGGCCCG
AATGGCTGGGGCGCCTTTGTGCAGCCGATCGATCACGACGATCTCGCTCTCGGCTCTTTTGCTCAGCGCTTCTGGTACGG
CACCGAGCACTGGCGCGGTCCCGGCTCGCCCATCTTGCTGATCACGCCCGGCGAGCAGTCCGGCACCGGCTTCAACGACA
CCTACCTGACCGACCAGCGCATCATCGGCCGCTTTGCCGCCGCTGTCGGCGCGGCCGTCGTCATCCTGGAGCATCGCTAC
TGGGGTGGCAGCGCGCCCTACGTCCGCCTAGACGGGCCTCGGCTGCGATACCTCACCGTCACCAATGCCCGGCGCGACCT
CGCCGCCTTTGCCCGCGGCTTCGTGCCACCCTTTGACACCTCCGGCCGCAGCTCGCCCGCCACTGCACCCTGGATCCTCG
GCGGTGGCTCGTATGCTGGTGCTCTGGCCGCCTGGGAGGCCGCTAGCGATAACCACCCGTTCTGGGCCTTTTATGCCACC
AGCGCCGTCGTCCAGTCGATCGGTGACTTCTGGCAGTACTTTGACACTGTTCGGCTCGCATCGCCCGCCAACTGCAGCGC
TGACCTCGTGGCTACCATCGCCCACGTCGACGAGGTGCTCACCAGCGGCAGCCTGTCGCAGAAGCTCGACCTCAAGGCTA
GCTTCCTGCTCGAGGACCTCGAGGACGCTGACTTTGCAAAGTAAGCACACCTCGCTACGGTCTCCTGCCGCTTCTGACTT
CGCAGTGCCCTCACATTTGGCCCTCTCCTGTGGCAGCAGACCCAGTTCTTCTCCGAGGCCGTGCTCGGCTACAACAGCTA
TCACATGTTCTGCAACTATATCGAGGTCTGCTTCACCATATTTCCGCTTGCCTGCCTCACAGCTAATACCAGCAGAACGT
GTGGCCCAACTCTACTAACCCTGTCCCTGGCCCCGAAGGCGTGGGTGTCTTCCGTGCTCTCGACGGTTATGCCAAGTGGT
TCACGCAGCGGGTGCTTCCAGGACGTAAGCCGGTATTTCTTTTTTACATCAGTCTCGTTTGCCTGCCAGCCTACTGACAC
AAATACCAGTCTGCCAGTCCCTCGGCTATGCCGACTTCGAGGGGCTCTACAACACCGGATGCTTTGCCAATCTGAACGCC
AGCAGCCCCATGTACAGCGATCTCTTGGTCGACAATCCGTTCAGCCGCCAGTGGTCCTGGCTGATGTGTAACGAGCCGTG
AGTGAAGAGCCTGTTTATCTGTGTTTCGTTTTTCTCGTTCTTGCCTTCTTGTCCCTGCCTTCTACCCATCCTCCACTGAC
CTTTCAGCCTCGTCTGGTTCCAAGATGCCTCCCCGACCGGTCAGCCCTCCATCATCTCCCGCCTCGTCAGCTACGACTAT
AACCTAGCCCAATGCGCTCTCATGTTTCCCGCCAGTGCCGGCGGCTTCGGCCTGCAGCACGGCCGCTCGCCGGTCGATGT
CAACGCTGCCACCGGCGGCTGGTCCGTCTCGCCGCAGCGCACGCCGCGTCTTCTTTACACCAACAACGAGCTCGACCCTT
GGCGTCCGGCCACGGTGAGCGCCCGCACTGGTCGGCCCGGTGGACCACTCATCAGCACGGGCGACGGCGACGACAAGGAG
CCTGTCCGCCTGATCGCCGGTGGTGGCCACTGCTCCGACATCTATGCTGCCAATTGGGCCGCCAACCCGGGTGCCAGGGC
TGCTGCCGAGGAACAGGCCGCCACTCTCGTCCGTTGGGTCGCCGAGTTTTACCACAACAAGGGGCTCGTGCAGCCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62