GenePrediction:GLEAN_6686 Details

Name: GLEAN_6686
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:721669..720723 (- strand)
Length: 947
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:721669..720818 (- strand)
Length: 852
Type: CDS
Source: GLEAN
Position: GCSC_156:720770..720723 (- strand)
Length: 48
>GLEAN_6686 class=GenePrediction position=GCSC_156:721669..720723 (- strand)
ATGGCTCCCACAGCACACACACCCCTGCCTCGGTCCCGGGCTAGCTCGCTGCCCACGACAGAACGCCCAAGCTTCCATGC
CGACAGGCCATACGACCTTGCCACAACATCAGACCACAGCCAGCTGAAGCACGTGGCGGCTCCTGCAAGCAAGTCATCGC
ACAGAGGATCGGGAGGCGACGGAGACACCAAGCTGCCGGAAAGGATGCACCGACAGGACTCTGGCTATGCTTCCATTGAC
CCCCGGTCACCGTCGCTGTCCCGGACAAGCACGCGGCGGCAGTCGTCGTTTACGAATCCGGCACGGGCGTCGTCATCGTC
AAATCACGTGAACCGCGTCGGAACCGCCACCCGTCGACCATCCAAGGCCGGCCTGGCCACGAGACCGCCCATTAGCTCCA
AGCGCAGTCGCCCCACCCACAACACATCGGCCCCGGCTCTGTACAGCTACGGCAACAACAGCACCTATCACGAGCCTTTT
CCGAGAGCGAGAGCGCCCAGCGGTGGCGTCGATGCTGAGCCTCCTGTCAGCGTCGAGATGGACAAGGAGACAACAGAGGA
AGAAGCCTATCCGAGCCCACCGCAGACGACACACTACTGGACCAGCGACCAGACCAGGCGGCTGGAGTACGCGGCCATCG
ATGCAGCCAGCCAGGGCTTCAAGGGCTGGATGTTGCGCCACGTTGTGCCCGAGTGTTTCGTGCCCAAAGATTTGCTGCGG
CCTGCGTTTGAGGACGAGACGGGCAGTGTGCGCCGCTATCGGCTCGAGCTAGCAACCGACGACTTGGCCAGCAAGGCAGG
CGAGCACTGCCCCGATGTGGTGGAGACTAGCGAGAAGAAGAAGGGCTGGCGTGTCAGGCGGTGGGTTTGCTGCAAATGAC
CACCCCTGACAGCTGACAGGACGACGACGAGACCGACGAAGACTTGACATTTGCATTTCGCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62