GenePrediction:GLEAN_6690 Details

Name: GLEAN_6690
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:693036..690130 (- strand)
Length: 2907
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:693036..691831 (- strand)
Length: 1206
Type: CDS
Source: GLEAN
Position: GCSC_156:691756..691663 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_156:691601..690130 (- strand)
Length: 1472
>GLEAN_6690 class=GenePrediction position=GCSC_156:693036..690130 (- strand)
ATGGTACGCGCTACTCTACCTCCTCATAGTCAGGAGCAAACCCGTTGTCTGAGCTCTGTCTCCGATGGCAACAAGCCGTT
TCCGCCACGCCTCCGCATCCCGGACTCACACAATGCGTATTCCATCCCCCTCGACAATGGTGGCTATCTGCATCAACCCC
ACTTTCAAGATGCCACCGCGGCCGAGAAAGGCTTCGCGGACCTGATGGGCACTCAATCGGACCACAGGCTTCTCAGCAGT
TCCCAACTGCCTCCGTCATTCTCAGGGTCCATGCCCAGTGGTGGTCTGCTTCTTGCCAACCCTTTTCCTTGGTCTCAAGT
CTCTTCCAATCATCAGACGGACACGGCCTATTGCGGCAGCCAGGGCCTCTTCAACCCCCCAAGTCAGAACGGAGGCTTTC
AGAGGAACTATATGTACGATGTTGGGAACGCATGGTCTTCGTACGAGCAAGAAACCCTGCGCCAGAGATCGATGTTTGCG
ACTCCGTCCATGACCATAGACAACACCTTTTCCCCAGTTCATACTCCGGGGCAATCTCAACCATACACACCCTCCTACTC
GCCTGTCACTCCAAACTCTGTCGGCAACTTCAGCGACCCGAACACGCCACAAACAATGCACCAACCCCCTGGAGTGCTTG
ATGGCATGGGTGGTGTCGGGTTTCCTTCTCAAACCTCTCTCATGATGGGTGCTGGGAATTTGAACCACGCCAACTCGTCG
GCGTTATTTGTCGATGACTTGCATAATGTAGCCCCCGGGTCGTGGTCCGATGCCAACGAAAACCACTCTGATTTGTCACC
TGGATACAGTAACTATCGTACGACAATCTTTACTCTTGATGCGGATCACTCTTCAATAAGCACTTCCCCGTCCATGGTCC
AATCCGTAAGCCACAGAGGCAGTGCTGCATCGATAAACAGCATCTGGAGAGATGACCCTTCTCCAATATCCTCTGCACCA
AGTCCTCTGTCCTACAACCGCTCCACCCCCCACAATGGCTCTCCTTCCAACAGCGCCTATGATCTTAGTGCTCATACTTA
CCGAGAACTAGACATCCCGGGCGGTGGCGCTCGTCATGTCTATTCCAACCGACACCTGAAGCGGGGACCGTCGGAAACTT
TGGACGCTTCGCAAAACGCGCATCAAAACAAGAAGCGCAATGGAAATCAAAGAGCCTGTCTGGCCTGCTATCTTGCTCAC
AAAAGAGTAAGCCTCCTCTTCCTCCACTCCTGTGTCTATGCTGTACTTGTCTGTACTGACAGTCACCTTACCCTGTCCAG
TGTCATGACCCTTGCGACAAGTGTGAACAGGCCGACGGCTCTTTCCCGGTCTGTGTCGGTTCGATCATCCGCGGAAAGAA
CATCTTCCTGGACTGTAAGTCTTCTGCTTGCATTTTCCCCTTTCCCGCCTGACATGCTAACAAGTCCGACAATAGGCCTG
GCCCTGAACGAAGCGGACATGAAGTTGGCCAAAGATATAATTAACCGTCGTGATCGCAACGGGTGTTCACCAACCAAACT
ATTCAACGAATTTGTTCATCGAGACGTTGATCTGAAACTGATGATGGAGGTGCTGTCGGACCATAAGGTGGGAAACTCGG
GCGCCTACACGTCCTTCTTTGAGAGCCACAACATGAAGAACCACCAGATCTTCTCGCCCTTTTACCAGGTCAACATTGCG
CTGCAGGGCCGCAAGCTGCTCGCAAACGATCCGCGGGTCAACTTCGTCGAGAGCGACCTGCTCATTCTGCGTGCCGTGTG
CGCCTCCCGGTTGCTTGCCTTTATCGAGAACGGGTTGGAGAAAAACAAGAAGCAGTTAAAATGGACCAAGCAGAAGGCGC
GCGACCTGATCGTCTTTCTGGCCATATCCTTGGAACAGGTGCTGTTTTTCCACACGACCATGGATGGTCCAATGGCTGAG
TCGTTGGTCCGCAAGCGCAACGACCTCGTCTACCACCTGGCCTATCTGCTGCGGCACATGGCCAAGGCTACCTTTCCCAA
TGGCAATCTCTTCTCGGAAGTCCACATTGGCCCCGACAACAGCGTCTTCCTGAAGAAGGAGTTTTGGTCTCACCTCAACG
TGCTTTACTTTGAGGCCTCAGTCAAGGACCTCCCTCCAAGTATTCAGAACAACGCTGGACCAGAGATGCCCAGCATTCAG
GTCACCCACGTCGGAGGTGGCTCAACCAAACCGGCCTCCAGGACCGGGAAGCGCCCCGTCTGCGAAGAATACGACGACGC
CCGAGACCATCCAGATGCATGCAATCTGCTGGAGGCGCGCATAAGCACAGACGATAACTCGGTTGACAAACTAGCTGCCA
CGTTGGAAGCTACCTGCATATCCTCCCCTCTCCCGCAGAGACCGTTACCGACTGAGTTTCACGTCGGTCAACTCATTGAC
AACATTTGGCACTGGGGCATGCCCGATTCCTTTGGAAGTGACAGCACAAGCCTCCGCACAGACGGAATTGTCTATGACAG
CCTTGGTGTGCAGACTTTGCCAGCCCGTTCCAGCAGCCCCCAAGGCGCGGCCATGGACCTACCCAGTGGCTCTGGTAGCA
GCAATGACGTGGGCTTGTCCAGTCCTCTTGACGTGACTGATGGCTTTGGATATTTAAACTTTGACGAATCAGACATCAGC
ATGTCTTTTGGCCTCTCTGACAACACCGGAGTGGAATGCCCAAACATCACTGCCGGTGTCTCCGAAATTCCTTACACACC
CACTTTCTCTGGGGTTTCTGTTGTTTGTCCAGAAACTCGGCAAATCAGAAGCACCAGTGTTAGCAGTGCATACGGAACGG
CAATGAATAACTCTGTTAGCCCGGTCTTTGATAATCCGCAGCAAAGTGGTATTCGTCGCCGGTATACAAGTGGGAAGGAG
AAGTTTCGCAAATTTTTCGGAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62