GenePrediction:GLEAN_6691 Details

Name: GLEAN_6691
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:674390..674156 (- strand)
Length: 235
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:674390..674369 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_156:674313..674156 (- strand)
Length: 158
>GLEAN_6691 class=GenePrediction position=GCSC_156:674390..674156 (- strand)
ATGCCTGCTTCCGACTCTCTTCGTAAGCAGACTACAACCTAAGACAGAGACCAAATCCCGCTCTATGTAATCTTCAGAGC
CTCCTTTGACCCCGGCCGAACGTGATATTGTCAAGTCATACGGCGGTTGGACCAACTTCATGCTTGCCATGGGCCTCAAG
CCGTGGGTGGACGATGATATGGCTGAAGGCAAGGCTATTCTGGAGGGTTTAGTCCACAATGATTCGGAACACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62