GenePrediction:GLEAN_6692 Details

Name: GLEAN_6692
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:673543..669687 (- strand)
Length: 3857
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:673543..673332 (- strand)
Length: 212
Type: CDS
Source: GLEAN
Position: GCSC_156:673275..672694 (- strand)
Length: 582
Type: CDS
Source: GLEAN
Position: GCSC_156:672306..671068 (- strand)
Length: 1239
Type: CDS
Source: GLEAN
Position: GCSC_156:671013..669687 (- strand)
Length: 1327
>GLEAN_6692 class=GenePrediction position=GCSC_156:673543..669687 (- strand)
ATGAAGATTCAGCTTTCTTTCTTGGCCTTGACGGCCTTTAGCCAGGCTGCTGTCGTCGCTAAGGATATAGCCAGCACGAT
AGAGACTTCTTCGAGCCCAAGCAGCGTCCCCCCTGGCTGCCTCGATCCTTCACTAATCCAGACAGCAAGCAATCGGACAG
GTCAGGAACGTGGGACCCCGGGCGTAGAACCGGGCGAGGTGTCATCGGAAATGTGAGCAGCCACGAGACGCCAAAGACAG
AAAATTACTGCTGGCTGACACAATTTAGAGACACCACCAACTTTATCAACTTTTGTGCTGGCCGCGAGCTCACCAACGGC
CGCCAGCTCTCGACATCGTCGTGTAACGGCATTCCCATGGGCCGCATCCCGGCCCATGACCGCATGATTGCGTCGCTGAT
TACTTCGCCGGCAACAGGGGAGCGTCTTCCGGCCCACATGGCCTTTAACATCACCATCCATACGGTGCACCTAACAGCAG
GCTACTTTGCAAATCCGCTGGCGAGCTACTACTCGGCGCCACAGGATCTGGACGAGAACGGCAACATCTATGGCCACTGC
CATGTCACGGTGCAGGAGCTGACGGTGAAGCGGCATGATTGGGGCGAAGTCGTGGTCAAGATCCCCGACCCGAGAAAGTT
TGTCTTTTTCACGGGAATCAGCGACGCTGGCGACGGTCGTGGGCGGCTTCAGGCAACTGTGGTGGGCGGTCTGCCGGTGG
GACATTACAGGGTGTGCACGATGATTGCGGCACGCAACCACCAGCCGGTGATGATGCCGGTAGCTCAGCGGGGAGCCCAA
GATGACTGTGTGCGGTTCCAGGTCATCGACGGGGACGAAGACTACTTTTCGTAGGACAGAAGAATTGAAGTTGGGGTTGT
CTTTGGGGGGGCTGATGGGTGTGGAAAAGTAAGACGAGTCTCGTGCCTCGAAATTGTACTAATCAGCAGCAGAGACTGAT
ATTGACACTAGAAGGTATTCTCATCAGTCGGCAGTTCAAACAATTTGAGTACTTGTGCAGCTTTTTTAGAATATTACGTG
CTGGAATTCGCGTATGTTTACGGACAATTGAAAATATGGACAATCCTGTTTTTTACTTCTGATTTGATAGATGAAATGAG
TATACCATCCCGACAAGGAGAGCAGTTGTGTGCCGATAGCTCTTTCCGGTTGGTGAGCTACAGATGCCGCGTTGCCATTG
GTCGATTGGACGGCCTAACTTCCTTACTTCACGTCAGAGGAAACTCTGCTGACAGGTTTAGGCAGCAGAACAGCAAAAGC
TTTACCGGCCTACGAAACGAACTGCAAATTGACCACAGCTGTCTGGCAATCTGGGAGATGCAGTCGACGACATTTCGTGC
CTGTGAGGCCTGTCGCATCCTCAAGGTGCGCTGCGAGCCGGCCAGTGGCGGTGGCCATGATGGCAGCATCAGCAGCAATG
ACGGGACCGTCTTGCCACCCGTATCGGAGCGGCCACCCTGCCGTCGGTGTCGAGACATTGGCCACGAGTGTGTCTACACG
GAGCGGCGGAGGACCAAGCGCAAGCGGACGGACGTGCGGGTGCGCGAGCTGGAGCAGGAGGTGTGGCAGCTGGGCGAGCT
GCTGTTTCTGCAGCAGAAACAGCAGCAGCAGCAAAGTGGTGATGCTGGAGGGGTGTTGGTGGAGGGCGTGCAAGAAGTCC
GAGTTCCAGAAAGGTCGTCTCCAATCGTGGAGGAATCACTCCCGACGGTTCCTTCTTTACCTCCTGCATTTGCCATCTCT
TCTGCTGGCACCCCCTCTCCCAACTTGCCACTGTCGTGGAACTCTTCCCTGCCAGCAACAGTCGACTCGGCAGACCCTGT
GGCTGCTGGACTTCTACCGATGGCTTGGGCGGTGCGCCTCTTTCGGCGATACGTCCTGACAATGGCACCCCAACGGCCGC
TCGTGGTGTTCCCTGCCGTGACGCCAGCAAACCATCACGTGATTCCGACAGATGAGGAGATAGCGGCAGTGGCAGCCAAG
GTACGGCGGCAGACCCCCGTACTCTTCCTAGCGATAGTCACGGTGGCGGGGAACATTGGCGCGGAGATGGGACAGAATGG
AGACGACGACGACGACGATGACGACGATGAGCTGAGCAATGGCCGAGACGGGTCTGCAGATATTAGTAACGACGAGAGCG
ACGGTCTCAGCCTGGCGCTGGAGGCACTCCTGCTGAGGGTCTTTGCCGAGCGGATCATGCTGGATGGGCAGAAGTCGATT
GAGCTGATCCAGGCGCTGCTGGTGTCGTCCAACTGGAACTGTCACTCACTGGGAGTCACGCCGCCGTCGAGCCATCGGCC
AAGATTCTACCAGCACGTCCACCTGGCTGCATCGATGGCCGTGGAGCTGGGTCTGTGCGGCCGTGAAGGACAGAACCGTC
CTCAAGACTCTGGTCCATCCGGCGACACCCTCGTCTTTGAGCGGACTCTGCTGGCCTGCTACCTCTGCTGTTCCAGGTGG
TTTTCTTGTCGTTTTCCGTCTCGTCTCAAACAGAAAACTAACATCAAAAGTGTCTCTCTCGGCTTCCACCGCCAGTCCAT
GTTGTCCTTTACGCCTCACATAGCCGAATGCCTCGCCACGATCGAGACATCGGCACTGGCAGCACCAACCGACGCCACTC
TGGCCGCCTGGGTTCGTCTGCAGCACATTGTCGATAACGCCGCAGTCGGCTTGGGCCTCCGGTCGTCTGAGCGCGACGGG
GCAGCCAGTAGCACAGACAAGGCCACCCGGGGCCTGGTGGACTTTGCGGACCCGTGCCTGCAGATGAACCTGCAGAATGC
CACGCTGCAGCTAGAGCAGTGGCGACAGAGCGTGACGAGCACATGCATGAACAACAGCCTGCTGATACAGTACCACACCG
TTCTGTGCACTCTGCACGAGTCGTGTTTCTACAACGAGTTTGACCCGACCGACTTCAAGCCGCCGTACCGCGTGGCTGTG
CCGACGTGCAGGGCGAACGCACCAGTGCCACCACAAAGACCAAAACCACGGCCTTTTCTTACGTCTGCTCACATCCAGTC
GCGCCAGCTGTGCCTCGCGTCGGCACGGGCGCTAATCGGCATCTTTCTGGCAGCGCCGACGAAGCAGCTTCGGGGCATGC
CGGTGTTCTCGTACGCGCGCATCAGCTACGCCATCGTTGTGCTGCTCAAACTGGAGCTGTCGGCCGTTCTTCCGGGCGGC
GCCATGCACGGGCTGATGCGCCACGTCGGCGGTCCAGGCAGCTCGACCACGCAGATCCACCACTATCTGGGCAAGCTGTC
GTGGCGGATGAGACAGCTCCGCACGCGGCACCGGCACCTAGCGCGCATGTGGGCACCGCTCGTGGAGGCGGTCAGCGAGT
GGTACGAAGGCTACCTGCTGCCGGCGGCAGGCGGTCACATCAGCGACGAGAAGGCGAGCACTGCGTCGGGCGTCGGCCCG
GTGCTACGACCACTACGACACTGCTTCCCGCTTTTGACGCAGAGTGAGGGTCAAGCCAGCACAGCAGCGGCAAGATTGAA
CCCAGAGTCTGCGATGGCTCCGGCGTCTTTGGTGGCACCGATAGGCGTGTCGGGATTCTACGAAATGCTGAACGAGATCG
GTTACCGGGAGTCAGCTGTGCCGATAGCATACGAGAACGGGACGACTGAGCAGGACTTGGAGCAGACTGACAGGTCTGCA
GGTGGGGACACGAGCTCGGTGTCGCGGGCGCCTGCTCATGTGAGCCATGAAGACGAACAGCTGCTCCAGTCAATGCTGCT
CATGGGAGATACCATCGACTGGACAGACCCGTCGAAGCAGTTTTTCGACGTGCAGAGCTGTCTCGACGGGATGTTTTCGG
AGCAGATGTCGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62