GenePrediction:GLEAN_6695 Details

Name: GLEAN_6695
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:648064..646622 (- strand)
Length: 1443
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:648064..647938 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_156:647875..647589 (- strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_156:647506..646622 (- strand)
Length: 885
>GLEAN_6695 class=GenePrediction position=GCSC_156:648064..646622 (- strand)
ATGAACTTCACCAAGAAAATTGACCGCGCCGTCCAATGGGCGGGCGAGAAGATGGGCGGCGAAGCCAAGACCAGCATGTC
GGAGGACTTCAAGATGCTCGAGACCGAGATGGCTCTCCGCTATGATGGTGAGTAGGCCCAACTGGCTGCTCGTCCCGCCT
CTCGCACCCCTCCTGCTAACACGCCCCAGGCATGGAACGTCTCCAGAGGTCGATGACTGCCTATGTCAAGTGGATCGGTC
GTCGTGGCGAGGTGTTTGAGGACAGAGAAAAGGGCGTGCCGGCGAGCTACCTTGGCCGCACGATGGTCGGTCACGGCGAG
GACTTCGAGCCGGACTCTGAGTTTGGCAACTGTCTCGTGACGCTCGGCCGTGCCAACGAGCGCATGGCTGCCATCCAGGA
GCAGTTTGTGGCCGATGCCACCGTGGCCTGGCTCGAGTCGCTTGACCGCAGCCTGGCTATGATGAAGGAGTATCAGGTGA
GCTTTTCTCTGTTTTTGTGTCTTGACCTTCTTGTCTTGCTTTCTCCACGCCTACCTCTTTCCCCGCTAACCCCAAAAGAA
TTCCCGCAAGAAGCTTGAGAACCGACGGCTTGCCTACGATGCCAGCATCACCAAGATGCAAAAGGCCAAGCGCGACGACT
TCCGCATCGAAGAGGAGCTGCGCACCAACCGGGCCAAGTACGAGGAGAGCAACGAGGACATCATGCGGCGCATGCAGGAC
ATCAAGGACGCCGAGGCCGACAGCATCCGTGACCTGACCAGCTTCATGGACTGCCAGCTGAGCTACCACGAGCGCTGTGC
CGACGAGCTGCGCCGCATCAAGCGGACGTGGCCGGGCGCCGCAACGGCTGCGAACGCCTCCAACAACGGTGGTTATGGCG
GCAGCAACAGCCTGTCGGTCGGTGGGTATGGCAATCGTAGCCGGTCGAACACAGCTCGTTCGTACAACAGCGAGCGGTAC
AACCCCAACAGCAACAACTTGCCCGAGGAGGAGCCGGAGCCGATGCCGGCACGCATGCCGATCCGGTCCAACAACCGGGT
GCCGAGCAACGGCAACTTGAACGGCAGCAACATGGCCACGCCGGAGAAGCCGCCGAGGCCCAGCCCAGCCATTCGGTCGA
ACACGTTTCAGGGCGCGGGCTCGAACGCGGCGGCGGCAACGGCAGCAGCAGCAGTGTCGTCGCTTCGTGGCGGGCTCCGG
CCTGTGGGCCGCACGATGACGAACAGCAGCAACAGCAGCGTGCACGTGGACGACGGCGACGACGGCAGCCCCGAATGGGG
TGGTGACCGCAGCGCATCGCCGGCCACAAGCTACAGCAGCCTCAATCGGTCGACTAGCAACCTGTCTGGCAACCCGGCCG
GCCGCAAGCCGCCACCGCCGCCGCCGATTCGGTCCAAGAAGCCGGCACCGCCTCCGCCGATGAAGCGTGAGGTGGGCTAC
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62