GenePrediction:GLEAN_6697 Details

Name: GLEAN_6697
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:637506..636639 (- strand)
Length: 868
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:637506..636794 (- strand)
Length: 713
Type: CDS
Source: GLEAN
Position: GCSC_156:636741..636639 (- strand)
Length: 103
>GLEAN_6697 class=GenePrediction position=GCSC_156:637506..636639 (- strand)
ATGGTCCTCACCCGCTCAGCTTCTGGTGTGGACGTGCCGCCGCCTCCGACTCCGTCTCGTTCGCGTGCCAGCACCCCGTC
GACTGCCCGGAAGCCGTCGACCCGAAAGGTGACCCCTCGCCAGTCAACACTGGCCTCTTTGTCGCCTTCGCCTCCGTCTT
CGCTACCACCTACACCTATCGCTCCTCCCTCTCCTCCTGCTCACACCTCCGCCCCGCCTCTCTGGTCTCATTCTCCCTCG
GGCCTGGCCCTCTTCTGGCTCGCCGTCTCGCTGCCGCTCGTTATCTGGGACTGTGGCTACGTCCTGCTGCGTCCCCATTC
GATGCCCGGCGGCTCGCTGCACTGGCCCATCTGGCAGCCGTACGCGCTTTACGGTGAGGTCGACCACGTCTACGGCCGCC
GGCAGTGGGACGCCCACGACGGCTTTGGCGCCGCCCAGGCTGTGCTCAACGTCGTCGAGACCGCCCTCTACCTCGGCTAC
ATCGGGATCTGGTCGCGCTGTCGCAAGACTGACAGCACGTCCGATGGCGTCGTTCAGACCGTCCAGACCGTCGGTGGCCG
GGCGGGTGCGCGTGCCCTGCTGATGCTCTTTGCCGCCGCCGTCATGACGCTCAGCAAGACCGTGCTGTACTGGCTTAACG
AGTACTTTTCTGGCTTCGCCAACATCGGCCACAACGACATCGTCTCGCTCGTCTTCCTCTGGATCATTCCCAAGTGCGTT
TCTTCTTCGTTCCACCTGCCTTTCTGCAATTACTAATCGGAACAGTGGCCTCTGGATCGTGTTCCCGGCCATAATGACTT
ACAAGACTGGTAGCGAGATCGTCACCGCCCTGGCCGGTCTGCCTCGGCCGGACGCCAAGAAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62