GenePrediction:GLEAN_669 Details

Name: GLEAN_669
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1304385..1307228 (+ strand)
Length: 2844
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1304385..1305299 (+ strand)
Length: 915
Type: CDS
Source: GLEAN
Position: GCSC_97:1305438..1306850 (+ strand)
Length: 1413
Type: CDS
Source: GLEAN
Position: GCSC_97:1307043..1307228 (+ strand)
Length: 186
>GLEAN_669 class=GenePrediction position=GCSC_97:1304385..1307228 (+ strand)
ATGGCGACTTTTGAGGCGGACGTCGGCCAGCTGACGTCGTCGGCCCAGATCTTTGCGTCGAGCCGGTCGCTGCCGCAGAT
CCGCGCCCTCCACAAGACTCTCAACGGGCAGGTCGACGACAAGGCTGCCCGCCTGCGTACGCAGGTTGGCGGCTCGTACC
GCGAGCTTCTGGGTACGGCCGATTCCATTGTGCAGATGCGTGGCGACATGGACGCCGTGCGGGCGACGCTGGCGAGCATG
GGCAACCGATGCGGTCGTGCCGCCGTGGGCGCCAAGGTGAACGCGCTGGCAACCTTTGCGAGTAGCAGCCAGGCCGGACG
AGACCACGAGAAAGATTCGCTCAGCGTGGCGGCTAGGGCACGGCTGCTGGAGGCGTGTGCCCGCACGGTGGCCCGGCTGC
TATCACGCTCGGCAGCGACGACGATAGCGACAAACGCCAAGCTTGCCAAACAGCAGCAGCCACAAAAGCCAGCACAGACC
TGGGGAGAGAGGCTGGTCCTGGCGGCAAAGGTATTGGTGCTCAGCCGGCTGCTCATCACCAGTCTGGCCGAGGACAAGTC
CAAGACGGAAAGCAAAAACGAGAAGAAAAGTACAATTCGAGACCCCACCGTGCGCATCTCGATCGAGGCGTCCAAGAAGA
CGCTCGCAAGCCTGCGCCGTCGGCTGCGCGACATGGTCGAAGTGCTGGAGCGGACGGTGCACCACCGACACTACGACGCG
CTGGTGGCAGCGAGAACGGGCGTAGACGGAGCGGTCGGCGATGCAGCGCTTGCGATGGACCTCAGCACCACCACGCACAC
CAGCCGGGCCGCAGCAGCGGCAGCAGCCCGCCGCGACGACCTCCTCCGGGCGCTGTGCGCCTACAGCCTGGCGACGACGT
CGGGCGCTCGCGACGTGCTCTGGCAGCTGCTGCACGTGCGCAGCCAGGCGATGGGACAAGTGCTGGAGCTTAACGGGGAG
GAGGAGGACGACGACGACAATGGCGACGATAAAGACGACGACAAGACCGACCGCACTGACAGAGTGCTGGACGGACTGGC
ACTATACACCAAGACGCTGCTGGACGTGCAGGCACTGCTGCCGCACCGGCTGCCCGAGGCGCTGCTGGGACTGAAACGAC
GGGCGCTGCTGGACGACGAGAGCCTGCAACAGATGGAGGGACTGGCACTGGATGTGCACGGGCGATGGTGCGGCGACGAC
GTGCAGTTCTTCAAGCCGTACATCCGACACGACGACCTGGACGCGGCACAGGCGCGCGACATGCTAGGCACGTGGGCCGA
ACGTGGCGCCGATGCGCTGCTGGCCGGCCTGCAGCGGGCATTGGGGGGTGTAGACGGGGCAGGGGACAGCCAGAAGAAGC
GACCCGGACAAGCACAGCTGGACCTGCACGCGATTGTGGACATGCGGCGACGGGTACTGCAGCTGTGGATCCGCGACAGC
AGCCGGGTGCGCGGGCTGGACCCGGCGGCATTGCTGGACCGGATCCGGCTGGTGTTGGGGCAGCACATGCAGCAGGTGCT
GGAGGCCAAGGTCGACAAGCTGCGGCTGGTCGGATCCGAGGTGGCGTCGACGGTGGCGTCATGGCGAGACAGCGTGGCAG
ACCGGCACGCAAGCTTGTGGGGGGGAGGAAGCCTGGACGTGGATGTGGACGTGGACGTGGACGTGGGTCTAGACACGGAT
CTCTCGTCCGGGGCGGTGCCGTTTGTGTGGGAGGTCGTGGGACGGCTGCACGGCCGCAGCGATGCGGTGGCGCGGGCGGT
GGCCTCGTTTGCGACATGGCGACGCGTGATGGACGACGCCGAGGCCGTGGTGGCGCAGCTGCGACGACAGCGCTGGGAGC
TGGAGGAGGGCGACGACGACGATGAGCACGGCGACGGCCTGGTCGAGGACGAGGACACGATCGCACAGCGCCAGCAGCTG
CTGAGCCGCGACGACCCGACAAGGCTGCAGGGCCGTCTGGAAGCGGCGCTGGCGACCGCGTTTGCCGATCTGGACCGACA
GATGGCCAGGACGTGGGCCCAGCTGGGGACAGAAGCAAACGACGGACAGGCGGACAGGGCCATGTACCTGGTGCGCGTGT
TGCGGGAGATCCGGGCGGGCGGAGGTGAACGCGTGGCCTCGCTCGGACTCGCCATCATCCCAGAGCTGCACGACACGATC
GTCCGGTCAGTGACAAGACCGGCACTGGAACAGTTTGTGGCGGGGGCCCTGGCACGGAGGACGGTGGCCGGACGCAGTCT
CTGGGAACTGGACAGGGACAGCGAGAAGGAGAAGGACGAGAAGGACGAAAAGAAAAACAGAAACGGGCTCGTCCTTCCAC
CATCGCCTTCGCCGGGTGTCTTTCGGTTTCTGCGCGACCTCTCGACGGCTATGAGCCGGGCTGGCATGGATCTCTGGAGT
CCGACGGCGGTGGCGGTGCTGAAGCGACACGTGGCGGCCGATCTGGCAGCGCGATGGATAGCCGTGGTGGAGGGATTAGA
GAGGGAGCGGGTGGAGGATGAGGAGGTGGGGGACAACGAAGAGAAGAAGGTGGACGAGGGCGAAGAAAACAAGGAAAAGG
ACGATGAGGACAAAGCCAGCAAAGCTAATGACAAGAACAGCAAAGACGACGAAGAGACGCCATCTCCACTCAACCCCCAC
ACTGACCTCCTCCTACAGTGGCTGCTGGACGCAGCCTGGTTGCACTGCTGCTTCGGATCGGCCGGCCAGCAGCCGTGGAT
GGACCTGGAAGAGCTGCTGGCCGGGCAGAGCGGACTGACGGCGGAAGCAGCGGCACGGCAGCGCATCATCAAGACGGCGC
GGGACTCATGGAAGAAGACGAGTCTGCTATTTGGGGTGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62