GenePrediction:GLEAN_66 Details

Name: GLEAN_66
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:433805..438475 (+ strand)
Length: 4671
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:433805..433921 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_179:433998..434709 (+ strand)
Length: 712
Type: CDS
Source: GLEAN
Position: GCSC_179:435055..437904 (+ strand)
Length: 2850
Type: CDS
Source: GLEAN
Position: GCSC_179:438096..438475 (+ strand)
Length: 380
>GLEAN_66 class=GenePrediction position=GCSC_179:433805..438475 (+ strand)
ATGGCGCCGCGAAAGAACACGCAATCCACGGCGGCGGAGCTGTCGCTGGTCCAACTGCAGAAGTGCTTTGTCAACCTGCC
GTCGTCGCTGGTGAACGTGTTGATGAACATTGACACGGTCGGTGCTCTCCTTTCCTTTCCCCTTTTTCCAGCCTCTCTCT
TCTTTTCTTCCTCGCCCTCGCCTAACATCTCAGCCGATTCAAAATGTCATCATCGAGCTCAGCTACCGCGCGCCCGCGCC
GCCACGCGCCGACGGCTCTGGCCCGTCTCCCACGACGCAACAGCGGTCTATCTTTGTCGGATGGACGGGCATGCCCAGCC
GGCGAAAGATGGCACCACTGCTAGGCCGCGACGGCCTCGCTAGCACACGGGCAGGCGCTGCCGGTCGCGAGCAGGAGATC
GCCGTCGTCGAGCTGGACGCGACCTTTGCCAACACTCTCGGCATGCGCGACGGCCAAAAGGTCACGGCCACCATCCATTT
GGAGCCGCGACTGGCACACACGATCCACATTGAGCCCCTGACGCCCGACGACTGGGAGATGGTCGAGCTGCACGCCACCT
TTCTCGAGATCAATCTCATGAACCAGATTCGCGCTCTGCCCAACCCAGCCGCCACCACGGCCGCCAACACCAACCACCCC
CTGACTCTCCACCTTTCGCCGACCTCGACCGCTAACGTCAAGGTCCTCTCGCTCGAGCCGCCGCTGCCTCCTGACGTGCT
GTTTGCCAAAGTCGCCCCCGATGCCGAGGTCATCGTCGCCCCCAAGACTCGACCCAAGCCGTCCCGGAGCGGCCGCGAGA
ACCGCAGCGTCACCAGCACGTCCAAGCGCAGTGGCACCAGCACAGCCCGTGGCCGCAGCGCCCGTGAGGAGCGCAAGCCC
GCCCTCTTTCTGCGCGCTGTCGACCGTGCCCTCTGCAACGAGTGGTTCGACAACGAAGACGACGACGATGAGGGTGGCGA
CAACGACAACGATGCTGCAAATGTCGACCCCGAAGCCGCGGCCCAGCACGACGACGGCCTTGCCATCTGGGTCGATCCTG
ACCTCCTCCTGCCGAACGAATTTCGCGGCCTTCAATATGCCGTTGTGACTCTGATGCGCTCGGGAGGTCCACGTGCAGTA
GCACCAGACGCTGCCAGTGGAGTGGTAGCAGCAGGAGGGGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGACCGGC
GGCGGCGGCGGCGGCGGCCGTAGCAACGTCGCCATCACAACCAACAACAGAACCAGCAACACGCATCGTCGTTCAGCTTT
GGCCCTGGGACGACCCGCCCAACGGACAGACGGCGGCGCTATCACCAGCGCTGTGCTCGGCGCTGGGCTGCCAGGGTATC
GTGGGCGGCATCGTGAAGATCGAACCGGCGATGGCACCCCTAGCAACCAAGCTGGTGCACAAGGTCAAGATCTTCCCGTT
CGGCGATATCAGCTTGAAGCAGACCACAGCGCTTAAGATCGGTGGAGAGGCACAGCTCGAGAAGGAGGAGACGATGCAGC
GGATCAAGTCCCTGTACGGCGGCAAGGCGGCCCATGGTGTCATGCAGGGCCCTCTGACTGACGGCCTGGTGCTTGGACTG
CCAGCAGCAGGAGCGACAGCAGCGACAGCAGATTGGACCGGAGGCATCGTAAAGCTGGGGACCGAGGCGGCCCAGGGCAC
CCACGAGCCGTCGACCCGGTGGATTCTCGGGTCGGCAGTGGCCAACGCGGCGTTTGAGATGCAGGCGCCAATACCGAAGC
CGTCGTGGGTGCAGGAGGCCGAGTCGGAGGCAGCAGCGGCAGCCGTGGCCGAGTCGGGATCCGATCTGAAGCTGCAGCCG
CTGGTAGGTATCGACGCGATCCTGGCGGACCTGCGCGATCATCTCTCGCACGGTTCGTCTGTGCTCCTAACCGGCTCACT
GGGATCAGGAAAGTCGTCGGTGGCACAGCACGTGGGGTCGGCGCTGAAGAAGAGCGAGTTCTTCCACGTGACGTATGTTC
CGTGCCGGAAGCTGGTCAACGAGGAGAGCCGAATCGCGGCGATTAAGGAGAGCCTCGGACGGGTGTTTATGGGGGCCAGC
TGGGGCGCGCGGTTGGGCGGCAAGGCGGTAGTGGTCCTGGACGACCTGGACCGACTGTGTCCGGCCGAGACAGAGCTAGT
GGTGCAGAGCGAGGAGGGACGCAGCCGGCAGCTCAGCGAGGGCGTGTGCGGGCTGGTGCGCCAGTACTGCGGCCGTGACG
GCGGGGTGGTGGTGCTGGCGACGGCGCAGGGCAAGGACAGCCTGCACAACGTCGTGGTGGGTGGCCATGTGGTGCGGGAG
ATTGTCGAGCTCAAGGCGCCCGACAAGGAGGCGCGCCGGAAGATGATGGAGCAGTTTGCGCGGCAGAACGCGGTGGAGGC
CAAGACCGACGACAACGATGATGGTGGCGACAACGACAACGACGACGACAACAACAGCAGTCGACCGGTGACGGCAGACG
GCCGGCCAGACGGCAGCGAAGACGGCTGGATGATGGAGGGAGGCGGTGGAGGGGGTTCCCGACGCAAGAACAAGAAAGGG
AACCAGAGAGGAAGAAGCAGCAGAGACAGAGAGAGCAAAGGCACGTTTGTGCTGCAGGAAGACCTGGACTTTCTCGATGT
GGCCGGTGAGACAGACGGGTTTATGCCGGGTGACCTGCAGCAGCTGGTGGCACGGGCAAAGAACGAGGCGCTGGTGCGGA
CGATCCGAGAGGCAGTGGCCAGTGGTGGTGGTGGTGGCGGTGGCAGCGGCAGATTCGAGGATGACTCGGACGCAGACGCA
GAGCTGATGGTGCCGTTGGGCCGAATCGACTTTGTCCGAGGCCGGAAGGGATTCACACCGACATCACTGCGTAACGTGGC
GCTGCAGCAGGCGAGGACGACATTTGCATCGATCGGCGGGCTCGGCGAGACGCGACGTGTGCTGCTGGAGACGCTGGCCT
ATCCGACACGATACGCCCCCATCTTTGCACAATGTCCGCTGCGGCTGCGCTCCGGACTGCTGCTGTACGGCTTTCCCGGC
TGCGGCAAGACGTTGCTGGCCGGTGCCGTTGCTGGCGAGTGCGGGCTCAACTTTATCAGCGTCAAGGGCCCCGAGATCCT
CAACAAGTACATTGGCGCGTCCGAGAAGAGCGTGCGCGACCTGTTTGCCCGCGCCCAGGCAGCTCGACCGTGTGTCTTGT
TCTTTGATGAGTTTGACGCCATCGCCCCGAAGCGTGGTCACGATTCGACCGGCGTGACTGACCGCGTCGTCAACCAGCTG
CTGACCCAGATGGATGGTGCCGAGGGCCTCTCGGGCGTCTATGTCCTGGCTGCCACTTCGCGTCCGGACCTCATCGACCC
AGCCCTGTTGCGGCCCGGCCGTCTGGACAAGTCGCTGCTCTGCGACATGCCCGATCGCGATGACCGTGTCGACATTGTGC
GCGCCCTCGTGCGCAAGGCCCGCGTCGACGACGACGTCCTGACCAACAACAGCCCCACCACCGATGCCCATTGGGCCGAC
ATCGCCCGCCGCACCGACGGCTTCTCCGGTGCCGACCTGCAGGCCCTCGTGTCCAACGCCCAGCTCGAGGCCATCCACGA
CGCGCTCGAGGACGACGGGGCTGCCGCGACGACAGCTGCTGCAGCCGGATCAAAGCGCGGCAAGAAGGCCACCCGAGACG
GTCCCGGCAGCTTTGTCACTTTCCGGTATGGCGACGAGGGCGATGAGGCCAACGGCGGCGGTTCTGCCAAGCAAAAGGCC
GTCCCGCGCTCGTCTGCGCTGGCCGAACGTGCCGCCATTGCCGCCAAGCTCGAGAGCATCAAGCGGACGCAGCGACGCGA
GCGGTCGACCAAGAGACTGGGTGCTGGCGGCCGTCCGACCACAGCCAACACGATCACCAACGGCAACGTCAACGGCGACG
GCGACGGCGACTCCAAGGATGCTGAAGTCGTCATCGGCTGGAAACACCTGCTGCGCGCCCTCGAGGCCACGCGGCCCAGC
ATCAGCGCCGAGGAGCGTCGCCGGCTTGAGCGCATCTACCGCGAGTTCGTCGTCGGTCGCAGCGGCGAGATGCGTGACGG
CCAGGGCAGCATGGCCATTGGTGAGCGGTCGAGCTTGATGTAGGACGAGCACACTTGTGGTTGGAGGCTGACAGCACTGT
TCGAGGCAAAGGCATGGGTGGAAAGCTTGCATCTTATTCTTATAATATACCGGGATTAGCTGGCCGTTGGTTGTCATACG
TTCGCATGTGCAGGCTGTCTCGCCTCTCCAGTCGATATCAACACTTCGTAGATATCACTGCCGGCACGCAGATGCAAACG
TCCGTCAGTGCCAATAGGAATGGCCGGCACCTCACTGCCACATGCAAGGCCGCTCACATCGACGGCGTGGACGGCATACG
AAGCTGCCTCGTCGACGGGCAGCTTGCGCGCCCGAACGCTGGATTGTGGTACGGCTGGATCGCGCACTCCCCCATCCTCG
CTGCCAAACGTAATGAAAAGCTCCAGTTCGTTCGTAGCGTAGCGACGAGCCCCAGTTGGCCGGCTGCCTGTAGAGTGGAA
GACGACGTCGTAGGGCGTATCATTGTGCCCTTCCTGGCCATGCCCAACCGCAATTTGCTGAACAGTGGCGTCGCTATCAC
TACCACTATCGGCCTTGTCCTGGCTTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62