GenePrediction:GLEAN_6700 Details

Name: GLEAN_6700
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:623026..621573 (- strand)
Length: 1454
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:623026..622931 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_156:622872..622823 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_156:622771..622640 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_156:622577..622511 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_156:622445..622405 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_156:622325..621808 (- strand)
Length: 518
Type: CDS
Source: GLEAN
Position: GCSC_156:621724..621573 (- strand)
Length: 152
>GLEAN_6700 class=GenePrediction position=GCSC_156:623026..621573 (- strand)
ATGTCTTCCGACGCAGCTAGAGGACCGGTATTGGCACCAACTGACCACACTGTTGCTAATACCATTGCAGCAGCCGTGGT
GCTAGCTGAAGGCGATGTATGACTTAGGGAATGGGGGGTCAAAGGCGAAATCAAAGCTGATGTTTATTTTTTAGGACACT
AACTTGGCCGAAGATGCCGATTTAGCTCTCGGTGACAACTACTCGTGGGTATCTCTCTTCCTGTTTTATAACACGTAACA
GCTAACGTGTTGTAGTCTTTCAACGGCGTCTGTGTCAAGCAGCATTTTGCAGTACCGCACAATTAATGGGCGGACGTTTC
ACAGCGACAAGTATGCAAACTACTTCATGCCCAACGATGGCCAGCAACAGGAGGCTATAGACATAGCGTATGTCTAAATT
GCAGTCCCTTAAGCCTTCCCTTCTTATATAGCTGACGGCATTTGAATAGGCACCATTACTTAACGCTACTCCTAAACGGC
GCATTTTTCCTAGCGCCTGTCAAAGACAACCTTAAAGTTAGTCTGTCTTAAGCAAATAGTGCTTTTTGTAATACTAATCT
TCTTCTACAATTTTTAATTAGAACGTGCTTGACATTGGCACCGGTACTGGTATTTGGGCAATGTAAGAAGTAATTCATTA
ATTCTCATTCTAAAGCCCCGCTAGAGAAGATCAGTTCAAACTCTAATTTTATGTCTGCTAGTGATGTTGCCGACCAATTT
CCAAATGCCCAGGTAATCGGTACGGACATCTCACCGATCCAGTCGATTTGGGTACCGCCTAACGCCAAGTTCGAGATTGA
TGACGCAACACAGCCATGGACCTGGCCTGACAACGCCTTTGATTTTGTTCACATTCGTTTCTTGGTAGGCGCCATCTCGG
ACTGGGATGCGCTATTCTCTCAGGCTTACCGCTGCTGCGAGCCAGGCGGCTGGTTTGAGTCGTGCGAGCTGCGTCCTGAG
CACCAGAGCGACAATGGAACGGACAAGAATTCCCCTATCTTCACTGAGTTCTGGCAGCTTTTTGAAACAGGCATGTCCAA
GCTAGGCCGTAATTTCAGCGTTGTCAAAGACGGCACCCAGCACAGGGCTATGAAGAAAGCAGGCTTCAAGAACATTGTAG
ACAAGACCTATAAGCTACCCTTGGGTAAATGGCCTGCTGATACAAAGCTGGCTGAGATAGGACAGTTCGCTCTGACCGCC
CTGCTTGAAGACTTGGAAGGTGTGTTCTTTTCCGTTTTATTCTTTTACACAGCCCCTCTTCTTTCAACTTCGTATGTACT
TTGAGATCGCTTACTTCAATAGGATATACCACCTTCTTGTGGAACAAAGTCTTGGAAAAAGGCGAGAAAGAGTTCCAGAT
CTTCCTTATGGAGATGCGCAAAGCCTTAAAGGATAAGAATTTACACACGTATTTTACTGTCCGCTACGTCTATGGCCAGA
AGCCGGTTGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62