GenePrediction:GLEAN_6701 Details

Name: GLEAN_6701
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:614103..612418 (- strand)
Length: 1686
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:614103..613970 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_156:613898..613776 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_156:613722..613461 (- strand)
Length: 262
Type: CDS
Source: GLEAN
Position: GCSC_156:613399..613253 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_156:613206..612418 (- strand)
Length: 789
>GLEAN_6701 class=GenePrediction position=GCSC_156:614103..612418 (- strand)
ATGGCGTCTCTTCCAGTTCGTCGCGTGGCCGTCATCGGCGCCGGCATCTCGGGAGTAAACACGGCAGCCCATCTTATCGC
CGAAGGCCTAGACGTGACCGTGTTCGAGCGATCGTCCGCCGTCGGAGGTGTTTGGTGCGTGAGCCGGCTCGATCGACGGA
AACAGAGAGAATGAGATGTCCCAAACGTGTGCTTACATGTCGCAGGGTCTTGAACCCGACGCGTCCTCTCGAGCCTACGT
ATCCCTCGTCCAAGGCGTCCGTAGCAGACGTTACGTTTCATAATGTTCCTGACAATGTCGATCCGTATCTTCTGCACTCG
CAGCCTGGGTCAGCACGTGCTTCTGAGCCCTCATTTCGAACCGTCGCTAACGCACAGACAGACCCTGCTACGATGGACTG
AAGAACAACGTCCCGATTGAGCTGCTGGAGGTCTCGCTGAACAAATGGAAGCCGAACACGCAGTCCTTTTCGACCCATGA
CGTTCTTTCAGACTACATCCAGGACACGGCCGCAAAGACGGGCGTCACCGAAAGGACCATGTTCGACACGAAAGTGGTCA
GCATCAAGAAAGACCGAGACGTGTGGCAGGTGACGACCAGCACATGGGATCATACCACGAAAAACGCCACCACGAGAGAC
TGGGTCAGTGTCCTATCCTCTGGCAGTGGTGGTTGGAGCTAGACTGACGCGCACATCCTTCCAGACATTCGATGCTGTCG
CCGTAGCTTCCGGCCACTATCACGCTCCCCAGATCCCTGCCATCAAAGGGTTGGCCGAGTGGAAGACTGCCTTTCCGTCA
AGGGTGCTGCACTCGAAGAGCTTCCGGAATGCCAAGGGCTTTGAGAAAAAGGTACGAGCTTCTGCTTCCTTTTTTACTTG
AGGAAACCATCTAACAGGCAGCTCAGACCGTGCTCGTGATTGGGGGCAGCGCGTCCTCAACCGACATCGCCGTCGAGCTG
TCGCCCGTCGCCAAAAAGGTGTGGCAGTCCACGCGCGACGGCCCCTTTGACCATCCGGCCGCGATGCTGCCGGCAAAAGC
CAAGCGGGTGGCCGAGATCCGCAGCTTTGGCCGGCTGACCGACGGTCCGGCGCCCGCGTCGGAGCCCATTCCGGCGACGG
TGACTCTGGTTGATGGCCGCACCATTGACGACATAGACGCCGTCTTTGTCGCCACGGGCTACCAGTTCAGCCTGCCATTC
CTTCCGCAGCTGCACAGAGACGACGTGGCACCACAGCAAGCCGACGACACCGTGCTGGTCACCGACGGCCAGCAGCTACA
CAACTTGCACAAAGACATCTTCTACATCCCAGATCCGACGCTCGCCTTTGTCGGCGTGCCTTTTTACACCGCAACGTTCT
CTCTTTTTGAGTTCCAGGCGATCACGGTCGCGGCCGTCTTCGCGGGCAAGACCGCCCTGCCACCGGTCCAGCAGCAGAGG
GCCGAATACGAGAAGCGGGTGCGGGACAAGGGCTACGGGAAGCTGTTCCACAACCTGCGCAGCCAGGACGTGGAGTACTC
GCGGGAGCTGATGGCATGGGTGAACGAGGGCCGGACGCCGGCAGAGCAGAAGCCGGACGGGTACTCTCCAAAATGGATAA
CAACCAAGGAGAAGATGCTAAAGGTGCCGAACAAGAAGAACATCTTGTATGCGGAAACACAAAAAAATGGGCTTGTGGTG
CAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62