GenePrediction:GLEAN_6702 Details

Name: GLEAN_6702
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:606671..605571 (- strand)
Length: 1101
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:606671..606131 (- strand)
Length: 541
Type: CDS
Source: GLEAN
Position: GCSC_156:606076..605571 (- strand)
Length: 506
>GLEAN_6702 class=GenePrediction position=GCSC_156:606671..605571 (- strand)
ATGGCCAGTCTTCCAGTCAAAGCCGTCAGGCGTGCGGCCGACCTGCGCCGTATACTCAAAGACACGCTTCCATGGACGGT
CTCGCCGCTGGTAGTGGGTGCACCGATGCGCGTGTTTTCGGGCCCATCGTTGGCCGTGGCCATCAGTCGTGCTGGTGGGC
TGGGCTTTATTGGGCCGGGCGCGACACCGCAGAGCACGGGTGCCGACCTAGCAGCGGCCACGGAACTTCTGACGAAGAAG
CCGATCGCGTTAGCGCCGCCGAGTGACAGTCTGCTCCCCGTCGGTGTCGGCCTGCTGCTATGGGACGGCGACCTGGACGA
GGCTGCGGCAACGATAGCACACCACCGGCCCTGCGCTGTCTGGTTGTACGCGCCACGCGATGGTCAGGCCGAGCTGGACC
GCTGGACACAGCAGCTTCGCGCGGCCTCTCCGGGAACGCAGGTGTGGGTGCAGGTCGGCACGCTGGCCGAGGCCGTGGCC
GCGGCTGCCAGCACGACGGCCCGTCCAGACGTTTTGGTCGTGCAGGGCGCCGAGGCGGGCGGTCATGGATGAGCCGATGA
CGGTGTCAGCGTGGTCACGCTACTGCCAGAGGTAGCTGATGCTATTGGGGGTACCAGTGCCGATAGCCGTCTTCCCCTCA
TCGCTACCGGTGGCATCGCCGACGGCCGCGGGCTTGTGGCCGCCCTTGGGCTCGGTGCTGCTGGAGTCGCCATGGGCACG
CGCTTTTTGGCCGCCACCGAGACTCGTGTGGCCAAGGCGTACCAGGACGAGGTGGTGCGGGCAACCGATGGCGCCGTCAG
CACCGGCCGCACGCTGCTGTACAACCACCTGCGCGGCACCTTTGGCTGGCCGCCTGGGTACAGCCCCCGTGGCCTGCTCA
ACCAGAGCTTCTCCGACGAGCGTGCTGGTGTGCCATTTGATGAGCTGCAGCGCCGCCATGACGCCGCCGCCAAGACTGGA
GGCACGGCTGCTTGGGGTCCCAACGGCCGCGTCGCCACTTACGCTGGGGCCGGTGTTGGGCTCGTTCACAGCGTGCAGGG
AGCCGGAGAGATCGTCGACAGTATCCGGATAGAGGCTCGGGAGATCATTGGTTGTTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62