GenePrediction:GLEAN_6705 Details

Name: GLEAN_6705
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:590937..586540 (- strand)
Length: 4398
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:590937..590167 (- strand)
Length: 771
Type: CDS
Source: GLEAN
Position: GCSC_156:590072..589325 (- strand)
Length: 748
Type: CDS
Source: GLEAN
Position: GCSC_156:589267..588832 (- strand)
Length: 436
Type: CDS
Source: GLEAN
Position: GCSC_156:588762..588683 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_156:588623..588390 (- strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_156:588335..588110 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_156:588047..586623 (- strand)
Length: 1425
Type: CDS
Source: GLEAN
Position: GCSC_156:586570..586540 (- strand)
Length: 31
>GLEAN_6705 class=GenePrediction position=GCSC_156:590937..586540 (- strand)
ATGAAGACAATTACGGCAATCATACCCAAAGGAACTGTCGAGAAGGCAGTACAGGCCATTACTTCCCAGGACTTTTCCCT
GCAGGGAGATATCGCCCTATTTGGCAACCCGGACCTTACTGCCACGCTGAAAGTGTGGCAAGGCCCATTACCTCCCAGCG
TGACTGGGTCTGTCAGCCTGATTCCCTGTGCCGAGCTGGCCACGCTGAAGCAGGACCAGCTTCGCCTCTCGTTGGTAGCC
CCCGGGCTTGCAGGCACCTCATTTGATGACATTGTGTTTCAGAAGGCGCAGATCTTCCATCAGAACTGCGCCATCGATCC
GAAGCGAAGTGTGGGGTGGAACATTGATGCCGACTGGGTCATCGACGCCTCATGCGGTACACTGCATGCCGTCCTGGTCC
GCCTGCTCGGCGTCGACCGGCCGACATTGCGGATGCACGGAGAGTTGGGGCCAAGCCAGAAGTGGACCGCCCTTCTCGAC
TTCCAGAGCATCACGCTGGAGGGGCAGTTCGCCGGCCTCGACGTTGTCCGCAGCGCACCTGCCGGCCTGCAGTTCACAAC
GCTCGGGGTCCGGCTCCTTGGAGCCCCGGGCGTCCCAGGTAACGCCATGAAATACAGCTATGCTGCTTTTGGAACACTGC
ACCTCGACATCCCGGAGTCGACGGCACCGCTGGAGCTAAGCTACGACATCCATGAAGCCAACGGCGAGGCTATACTTCAG
GCACAACTAGGATCGGCTTGGTCTAATGCTTTTGGTGTCACCGGGCTAACTGTCTGTTTCCTTTTTCTTTTCATTCATTC
TTCTCTTCCCCTTCTCTTTGGTTCTATCAGTATTCCGGTCTATATGAACTAACAAACATGGATAGATATCCACGGCGTCT
TTCACCACCAAGTTATCCGTCGAGTCGCCATGGGAACACGCCGAATTTGATGTATCTGCTTCTTTCAAGCACAAGGACAC
TCAAATCGACTTTCAGGGAACGTATGCACCTGGCGGCGCCTTTGACCTGAAAGCAACAGTCGCTCCATTTGACATCAGTA
TCATTGGTAACGTCTTCGATGCCTTCCATGGCTGTGCAATTTCAGTCCCCGATATCGATGTCAAGATCCAGTCTGCCACA
TTTTCCATCGTGTCTGGAAAGGGACTAGAAGTCCACCTGAACAATGTCGAGCTGGCCGACCACACTGCAGCCACTGCTGT
TCTGACAGATAGCCCAGACGGCGTTGTCATTCGCGGAGATCTGGGAGACAAGGTCGAGCTGGACGATGTCCTGCTGAAGA
ATGCCTATATCCAGGTGACTCTACCATCCTCATCTAATCAAGACAAACGCGGATCCGATGCTGTTTTGGGTGGCCAGGTG
GAGGTCCTGAAGGGACTTGACGTTGATAGCACAGCCCACCTGTACCAGAATAAGAACAAGACCGGATACGAATGGGCGAT
GGTGGCAGACTTGACACCAAAGGAGAACGACGCTTGGGAACTATCAAAGTTGGTCCCAGAGGTGCACGGCACGCCCCTAG
ACCTGAGTCTCACTAAGGTGGTATTTACTGCAGCCTCCCAGGACAATCCAGAGGTGGGAAGCACACTTGGTAGCAACTAC
TCCATCCAGAAGGGTAAGATCTTGTTTCTGCCCTTTCCCCCCCCCTTTTTCAACTTTCTAACCGAATCAGGAATTCAGTT
TCACGGAACAGTGTCTGGTGGCATCTTAGCCTTGGATTCACTTACGCGCAAGTCGCATGAAGGGCTCAGCATGCGTGCCG
GGCCGTCCTCGAAGGGATTCGACATTGAGCTCTTCACCCCGTCTGAGACTTGTATCTCACTCGGCAACGGACTGATGACC
ACGCCCATCGTGCTGAAGATAGAGACCCAGCCATCTGTACGTCTGATGGTTTCTGCCGGACTCAGCATCAAATTGTCAGA
GTCCGGCGAGCCTCTGAACTTTGGCGTGACATTTGATGCCGGTGTAAACAGTGCCTCGGCAACAGGTGAGATGGCAGGCT
GGTGGGCCAATCCATGCAACGCTGGCCAGAATGTCAAGCTGGGGCCAAGCTTGGCACTGGATCTCGAGATCATCTATGCT
CAGTTTGTTTCCACCGGAACCGTAAGGTGTGTTTCCCCAACAGCGAAGCCTCATTCATTTTATACAGGTGGTTGCTGACT
AACATCCTTTCAAAGCGGATTTGGGCTGCGAGGCGGCATCATGATCGGCAAGACAGAGGCCCAGTGTGCCATGCAGATCA
GCGAAGACCCTATGCGTAAGTCACACGCAGTCCTGACTGCTCGTCAGCCTAGCACTGACTCTCTCGTTTGCTAGGAGACA
TGCTTTCGGCCGAGGTTGGAGCATTGACGCTGGAGGATCTGACCTCGTTTCACTGCGATGTCACAGGAGTCTCTATCCCT
ACGCCTCCTGGTGGCTGCATGACATTCGAGAAGGTAAAGCTCTACATCTGCCCTGCTGGAACGACACTTGGCACGGTCAG
CTATCCGCAAGGCTGTTCCTTTATGGCCGACATGATCTTCTTTGGCAAACGTGCCGATATTGCATGCTGTAAGCACACTC
CAGGACTATTCGTACAACTGTCTTTTACCTAACAGACTCCAGCTATGAGCAAAACAGAAGGAATTTGCATCCAAGGCGGT
GTCGACAACTTCGAGCTTGGCCCGCTTACGGTGAGAGGAAAGACCGGACCACGAGCCACGCTGGATTGCACCCTCGGCCC
ATCATCGCAGCACATTCTTGTTGATGGTGTTGCCACATTTCTCGAGGACGATGTCGAAGTCCACGTCGACATTAGCACGT
TACCAGAACAGGCGGTCACCTTTTCCATGTACGGACAATCCTCAACTGCTCCCCTTGTTTCAGAGGTAGTCTAACAGACG
GTGTTTCTAGGAATGTCACTTTTGCCGACGAACTGAAGTTTGATCTTCACGCTTCAATGCACGGCCATCTGGCCTTTGAC
CGCAGTTTGTTGGACGCAGATTTTGCCCTTGAAGCTGAGTTGGAGCAGCATATTATTGAGCACATCCAGACACATCTCCT
TGAAGAGCTGAAGAAAGCTCACCATGCTCCGGCTGCCGGCATCGACGCCGCAGACAAGACCCTACAGACAGAGAAGCAGA
AGGTGGAGGACAGCATTCAGACGGCAAAGAAGGACGTGGGTGACACATGCCAGACATGGGAGTCGAAGCAGAAGGAAGTC
ACCAGCACGGCTGGGTCCACTGTCGAGACCTACCAAAAGGAGGTCAGCCGTCTCGAAGATGACGTCAAGGCAGCCCGCAA
CAAGTACAACGAGGCCGTGGCGGCGGCCGAGCAGGACGTGAAGAAGGCCAACAGCGATCGGGAGGAAGCGATGAAGGCAG
CAAAGAGCGACCTCGAAAAGGCCCAGAACGAGGCAACTCAGGCCATTGCTGCAGCACAAAAAGCAGTGGACGATGCCCAA
GCCGACGTGGACCGCCTGTTTGGAGCCGCCCGGGGCAATATCGACGCGGCAGAGGCAAAGGTGCAGACGCTGCAGAAATA
CATGGACGCGCAATGGGAGACGGTGTACGCCTACGAGACGCCGTCCTGGTACGAAGCCTGGAAGCTGGCCCTGGTTCCGA
GCCTCATGGTGCCCATCGCAGCACTCAAGGCAGCCAAGGTGATTGCGGACGGCACGCTGGAGTCTGCCAAGGCCGTCCTG
TACTCGACCGAATATGTCGAGAAGCAGACGTTGCTAGCCGCAGCCAACAGCGCGCTCGAGGCAGCCAAGGCCACCAGCGA
TGAGGCCATCGAGGCAGCGAGCGCATCTATGAACGCGGCCGACGAGACGTCGCGTGTTGCCGTCAGCGCGTCTACCGAAG
CCATGGACGCCGCGCGCCAGGGCGTCGCCTATGGAGTCCTGCAGTCCGCCATTCTTCGCCTAAACGACTACAAGAGGCAC
AACGAGGAATCCTACCAGGCGGCCTCCCAAACCGTCAACGAATTGGAAAACTGCCTTGAGCATGTCGCACACGAGTCCGC
TAAGGCCGCCTTGTCCGCAGTCGAGAGTGCGGCGACAGAGAGCATAGATGTCGCCCAGAAGGCGCTCGACGAAGCCCATG
AGGCTGGCGACTTCGCCCTCGACATCGCCGGCAAGATTGCAGAAGAATCCTTGCAGACCGTGGATATCCGTCACGTGCAC
ATCTCGGGCAGCCTCCGCGGTCTCGTCACGTGCGACAACAGCACGCCGTTGCAGGCCCACGTTGAAGTCGTCCTCCTCGG
CCATGCCATGCCAGTGATCGATGTCACCTACGACCCGAAGGATTCGATGGCGTTGGTCACGAGCATCTTTGAAGAGTAAG
TTCTCCGTTGCTCTGTTTGTTGATTGTGATGCTAATGATGATCATAGGGTGTGGAAAAACATTGACATACTCAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62