GenePrediction:GLEAN_6706 Details

Name: GLEAN_6706
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:585203..583713 (- strand)
Length: 1491
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:585203..583954 (- strand)
Length: 1250
Type: CDS
Source: GLEAN
Position: GCSC_156:583893..583713 (- strand)
Length: 181
>GLEAN_6706 class=GenePrediction position=GCSC_156:585203..583713 (- strand)
ATGGCTCCCCAGTTGGACGGCTTCTTCAAGCAGGTCGACGACCTGTCGAGCCACTTTATCAAGCGGCTGAGCCAGGCCGT
AGCAATCCCGTCGATCTCGTCGGATGCCGCGCGGCGGCCGGACGTGGTGCGCATGGCGCACTTTCTGGAGAAGGAGCTGA
CGTCGCTGGGAGCCGAGGTCGAGCTGCGGGCACTGGGCAAGCAGCCCGACCAGCCGACGCTGGACCTGCCGCCAGTTGTG
CTGGCGCGCTACGGCCGCGACGCGAGCAAGCGCACGATCCTAGTGTACGGACACTACGACGTGCAGCCGGCCGAGAAGTC
GGACGGCTGGAACACGGAGCCGTTCACGCTCGTGGTGGACGAGCAGGACCGGATGCTGGGCCGCGGATCGACCGACGACA
AGGGCCCGGTGCTGGGCTGGCTCAACGCGATCGAGGCGCACCAAAAGGCCGGCGTGGACTTCCCGGTCAACCTGCTGATG
TGCTTCGAGGGCATGGAGGAGTACGGGTCCGAGGGCCTGGACGATCTGATTCGGGCCGAGGCCAAGAAGTTCTTTGCCGA
CACGGACGCTGTCTGCATCTCGGACAACTACTGGCTGGGCACGGAGAAGCCGTGCCTGACGTACGGGCTGCGCGGCTGCA
ACTACTACTCGGTCGAGATCGCGGGGCCGGGCCAGGACCTGCACAGCGGCGTGTTTGGCGGCACGGCCCAGGAGCCCATG
ACGGACCTTGTCCGCGTCCTCGGCACGCTCGTCGACACGGACGGCAAGATCCAGATTCCCGGCATCGCCGAGCAGGTGGC
GCCGGTGACGACCGGCGAGGAGTCGCTCTACGACGGCATTGCCTTCACCATGGACACGCTCCACGAGGCGCTCGGTAGCA
AGACGACCATCTTTGAGGACAAGAAGTCGACGCTGATGGCGCGCTGGCGCTACCCGTCGCTGTCGGTGCACGGCATCGAA
GGTGCCTTCTCGGCGCCCGGCGCCAAGACGGTCATCCCGGCCAAGGTCATCGGCAAGTTCTCCATCCGCACGGTGCCCGA
CATGGAGATCGACAAGACCAACGAGTTCGTGTACAAGTACGTCAAGGAGCAGTTTGCCAAGCTGGGCAGCAAGAACACGC
TCAAGGTGTACGCCCAGCACACCGGCAACTGGTGGGTGGCTAGCCCGAAGCACTGGAACTTTGAGGCCGCTGCCAAGGCT
GTGGAGCGCGTCTGGGGTGTCGCACCCGACTTTACGCGCGAGGGCGGAAGGTGAGAGATGAAATGAACCCCCTGCATCGC
AACGAAAGTATATACTGACGAATTGAACAGCATCCCGGTCACGCTCACGTTTGAGCAGGCAACTGGCAAGAACGTGCTGT
TGCTGCCGATGGGCAGCGCCACGGACGGCGCCCACTCGATCAACGAGAAGCTGGACAAGAAGAACTACATTGAGGGCATC
AAGCTGCTGGGAGCGTATCTCCACTACGTTGCCGTGGAGCCGCAGTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62