GenePrediction:GLEAN_6709 Details

Name: GLEAN_6709
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:565852..563888 (- strand)
Length: 1965
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:565852..563888 (- strand)
Length: 1965
>GLEAN_6709 class=GenePrediction position=GCSC_156:565852..563888 (- strand)
ATGTACCATCTTCGTCGTTTTTCGATCGCTTCGGTATGTGTCGGCTCGGTCATATTCGTCTTCTGGCTGCTACCGCTGCT
GCTCAACCCGACACCTCCGACGGCAGAGCAAAGACGCCGCGACCATGCATGGGTGAGCACGAGTCACCACTGGCTCGACC
GTCAGGCCTGCCGATGGTTCAGCCTCTGCGGCGTGCAACACCTTCGACGAGACCTGCCGGAACGACTGAGGAAGGCCCCG
GACAACGACAGCGGTGACCTGCGCCTGGAGCTGCGGTCTCTGTCGGCGCCTATCGACAGCCTTCAGTGGCGGACGCGAGA
GTCTCTCGGCGACGAGAGCTGGGAGATCGCAGGACAGGATCAGGCAACCGAGGCAGAAGCAGCAGTTGTTCAGGAGACGG
CGCCGCAGCCTGAACACGATGCAGTATCCGCTGCCGACAGCAGCAGCGACAAGAAGGCGATCCCCGACTATGTGCTTGCC
TACGCACCCATGGTCCATCTTTTCTCGGACGAACACTTCTGGCCTTCGCACATCGGCGAACACGTCAAGCACATGGAGGC
TTTTACCAACGGCTCGGCACTCACGCATCCATTTCCACTGACGCTCGACAATATGGCACAACTGAACAACGAAACAGGCA
AGGTGTACCTCACCAGCATGGACGACGTGGAGGAAAGACCGGCGTGGTTGCTGAGCCGTGCCAATAAGCCGATCCCGTTT
GCGGACGACGAGAACAGCGATGGCGATAACCAGGGTGACGGGCAGAGAAAGCCGCGAGAAGACGGCAGCGGTCACGCCAC
TGACCCCCGGCGGAAGTACCCTGACGACACCACTTGGTTTGACGTCGACAGAGACCACCCGCTGCACCAGCTGTCGGACC
CGCGCAAGATCCTCAGCTTGGACCGACACCCACGAATGGACGGTCCTGAAGACACGCGCGCGCACCGCTCGCGGATTGAA
AATCTGCACCAGGCTGCCGGTGGTGTTTCGGGTTTTGCCAACGTTGTCAACGCGGCTGTCGCCGGGGCTGCAACTGCTGT
CGACGCCATTGTCCCTCTCGAGACAGCGGCGGCGACAGACGGTAAGACTCCCACGCAACAGAAGCCGATTGTAGTGGTGG
AACCGCAATACGGCCACAAGCCCGACGACAGTGGCTATTCGGCAGCGCCTGCGATCCTGGTGATGGTCGACAAGGGCTCC
GGCATCATGGACGCGTTTTGGTTCTTTTTCTACAGCTACAACCTCGGCCAGACGGTGCTGGGTGTGCGGTACGGCAACCA
TATAGGCGACTGGGAGCACTGCATGATTCGTTTCGAGAACGGCGTGCCCCGGGCGCTCTTCCTCAGCGAGCACGAAGGCG
GCCAGGCGTACGCGTGGGGTGCGCTTGAAAAGTTCCAGCCGAAGCGGAGCGCAGACGAGGATGCCAATCTACCGCCGCTG
CCAAAACGGCCGGTCATCTACTCGGCCGTTGGCAGTCATGCTATGTATGCTGTCCCGGGCAATCATCCGTATGTGCTGCC
GTTCCAGATGCTCAAGGACGTGACGGACAAGGGCCCGCTCTGGGACCCGGCCAAGAACAACCTGGCGTACCATTACGACT
ATGTCATTGGCGAAAACGAGGCTGGCAGCAACGAGGACATCGACGAGGGCGACGACGAGAGCGAGATCAGTGACAACAGC
GGCGACGACGATGGCGACGATACGACCTCTCCACTGCTTACAAGCCTCACGCCAGCTGCCTCTAACCCTGATGCGCCCAC
ATCGTGGTTCCACTTCACGGGTACATGGGGCGATGAGCTGTACGAACTGGGCGACAAGCGGCAGTGGCGGTTGTTTGGAC
AGTACCACTATATCACAGGGCCGGTGGGACCCAAGTTCAAGAACCTGCAGCGGAAAAAGGTATGCCAGACGAAGCGATGT
CGCATCCTCTTCCATCTCGAAGACGGCGGGACGTGGTACCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62