GenePrediction:GLEAN_670 Details

Name: GLEAN_670
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1323951..1326256 (+ strand)
Length: 2306
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1323951..1324016 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_97:1324084..1324123 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_97:1324184..1324260 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_97:1324349..1324405 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_97:1324474..1324599 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_97:1324657..1324677 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_97:1324741..1324902 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_97:1324965..1325024 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_97:1325102..1325202 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_97:1325248..1325680 (+ strand)
Length: 433
Type: CDS
Source: GLEAN
Position: GCSC_97:1325861..1326256 (+ strand)
Length: 396
>GLEAN_670 class=GenePrediction position=GCSC_97:1323951..1326256 (+ strand)
ATGGCACCACCGCCAACACCGCTCGAGTGGGAACTGCCCAAGCTGCGGTACTCGCTCAGCTTCGAGGTAACAAACACGTG
CTCATTTCTCTTCCCAGTCGGGCTCGACCGGCTGACTGGTCCCTGCGCTGTAGGACGACAAGAAGTACGTCGATGACGTC
GGTCTGGACACAGGTAGACAGATCCTCCTCCTTACTCTTTCGTCTCTCGTCTTCCGTTGCTGACGGAGGACAGACTTCTT
CGATGTCAAGTTTTACCCGTATAGCCCAGCCGGGAGCAACCCGGTGTTTGCAGCCGTGAGCAAGCGTCACGTGAGTCTGC
CGGACAATGTCCTTAGAATGTGCTTCCCTTGGCTGAAATCAAACAACGGGCCAGATCTTCGTCTGCCGTCTCTGTCAGAC
AAAGGACAAGGACGCCAACCCATGCGAGGTCATCCAAATCATCCGGGACGACGACGTATGTTGTGCAGCCGCTCCCTCTT
CATCTTCTGCCAGTCTGTCGGCTGCTGACGTTTGCGGGCTCAGCTCGGCGCGTTGAACTGCTCATGCACGTGGACCAAGG
ACCCGGAGACGGACCGAGCACTCCTCTGCGTGGCCGGCAGAGACTCCAAGGTCAAAGTATACAACATACGGGATGGCACG
CCAGTAACGGTTCGTCTTCCTCTTCGTGTCTCCCGCTTTCTGCCGACACGCGCTGACCACTCGCAGTCGTTTGTTGGCCA
TGGCGGAGTGAGTGCATCTCCGGGCTCTCTCGACACGCCCAGGTGTCGACACGCTGACAGGCGGTGATAGGAAATCAACG
ATCTGGCGACTTCGCCGGCCAACCCGTGCCTCATCGCGTCAGCCTCGGACGACACGACGGTCCGCATCTGGAGTCTCGAT
CCGGTCCACAGGCGACAGCCGTGCGTGTGTCTCCTCGCAGGCGAGGGCCACTCGTGGAACCTGCTGAGTGTGGTGCGTTG
TCGTCTGACCGTGCGGCCGTCTGCTCTGTGATGACTGCTAACACGGCCGTGTAGGCCTTTCATGACTCTGGCCGTTACGT
TCTGTCTGCAGGACACGACCAGGTTATCAACCTTGTGAGCAGAATGTCTCATGTCTTTTGTATTGCTGGGGCACCCGTTC
GAGACAGCCATTCTGACCCGGTCTCGGCCAGTGGACGCTTCCAGACTTTCCCCAAGAGCACATCGAGACGCCTTTTGTCG
TGCACTATCCTCACTTTTCGACATCGGAGATCCACACGGGTTTGATTGACTGGTATGTTGTTCCCAATCGCTGTGAGGAC
ACGACCTGACGGTGCAGCGTCTCCTTTTTCGGCGATCTGATCCTGTCGCGGGCCTGCCACGAAGACGTGATTGTGCTGTG
GTGCATCGAGGGCTTCAGCTCGCTGGACGACGCGCCGTCGCCGGAGCAGGCCCCGTCCAACCACGACACGTCCAAGCTGA
CGCGGTCTTCCTTTTCGGCCGCCGGGACCGTGTCAACGCCAGCCGGCTCCAACGGGCCGACAGCAGCAGCAGCAACGGCA
GCACCGTCGTCGTTGTCGTCTACGACGCATCCGCAGTACACCCGTCTGCTGCAGCTGCACACGCCCGGCTGCGGGTCGCA
GTTCTTTACGCGCTTCGGCCTGTTCAACGTGGCCGGCCACCACCCGACGCTGGCCTTTTGCAACACGTATGCCAAGATTT
TCTTCTGGGACTTTGCCTGCTTCCCGGCGTACCAGGAGTTTATCGCGGCTGTGAGGCAGGGCAGCAGCGGCGGCGACGGG
CTCGTCAACAGCGCCGGCGTCACGCGACCGCGATGGCTGCGGCTGCTGGCCCCGAGACGTCGACACGCCGGCAGCAACAA
CGTGCCGACCGGCCGACGGGGCGACAGCGCCGGACGGCTGCGCGAGGCCAGCAGCAGCGTCGTGCGCGAGGCCGACCGCG
TCGAGGCCAGCGACAAGGACTCGGTCTTTTCAGTGCCCGTGGGCTCGGCTGCAAACCCGAACACAAACACAAACACAAAT
CCAGTCCCAAACACAAATACGCCCGACCCCGACACGACGCATGCGGCACCCGCAGCCAAGGTCGAACACTACAACGCGGA
GACGCTCGAGGACTGGCACAACAAGTACGACACCAGCGACCCGCACGCGCAGCTCAAGGCGCACAAGACCGAGGGCACGT
CCAAGGCGCTCTCGACGGTGGGCCGGCAGGTGGCCTGGAGCCCTGAGGGCGACTGGTGCGTGGTCGTGGGCAGCAACAGC
CAGGTGCTGATCCTGCAGCGGTGGGCCAACGGGGAGATGGCAGCGACGGGCGAGACTGGGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62