GenePrediction:GLEAN_6712 Details

Name: GLEAN_6712
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:555543..554883 (- strand)
Length: 661
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:555543..555405 (- strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_156:555328..555237 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_156:555149..554883 (- strand)
Length: 267
>GLEAN_6712 class=GenePrediction position=GCSC_156:555543..554883 (- strand)
ATGCCTGACCAAGTCTCTGTCCTCTTCTGCTGCATGGGCAACATCTGCCGCTCGACCATGTCCGAGGGCGTTTTCCAGGC
CATGACCAAGAAGGCGCCCTACGAGGGATGCATCGCCAAGATTGATTCGTGCGGAACGAGTGAGTGAGCAGATGCAAACC
TGATGGCACAGGCAGACGATGCTTTTTAGCTGATCCATGCCTATGTTCATTGCAGTCGGCTACCACACGGGCGACGATCC
AGATGACCGCACCATGGCCACGCTGAAGCAGAACGGCATCACCGACTACCACCATCGCGCAAGAAAGGTGCGTCCGAGAA
GCTAAAGGGTTTTTGCGGCGAGAAGCGAGGCAGGACATTGAGGATGCAGGGCTGACGCTGCTCGACGGCCGCAGATCTGC
GCCGCCGACTTTGACCGCTTCGACTACATCTTCGCCATGGACCGTCAGAACCTAAACGACCTAGAGACGCTGAAGCGACG
AAAGCCCGACAGCAAGGCGCGCGTGCAGCTCTTTGGCGAGTACTCGGGCACAGGACGCGCCGAGGTGATATCCGACCCCT
ACTACGGCGGCCACGACGGCTTCACCAAGACGTACGAGCAAGCCACCCGGTTCAGCCAGAACTTTCTCAAGGCAATCTTC
CCCGACATTGAGACGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62